Mutagenetix > Incidental Mutations

Incidental Mutation 'R1312:Insrr'

157958

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

MMRRC Submission

039378-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R1312 (G1)

Quality Score

135

Status

Validated

Chromosome

Chromosomal Location

87796951-87816101 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87800490 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 80 (T80A)

Ref Sequence

ENSEMBL: ENSMUSP00000103208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029711
AA Change: T80A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: T80A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107582
AA Change: T80A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: T80A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166771

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166866

Meta Mutation Damage Score

0.278

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.0%
20x: 85.7%

Validation Efficiency

98% (41/42)

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	A	T	4: 103,270,797	F44I	probably damaging	Het
Acot10	A	G	15: 20,666,499	V52A	probably benign	Het
Arhgap32	T	C	9: 32,255,312	V415A	probably benign	Het
Cacna2d3	T	C	14: 29,045,668	D750G	probably benign	Het
Cdh15	G	A	8: 122,861,449		probably benign	Het
Dusp27	A	T	1: 166,099,291	N917K	possibly damaging	Het
Edem2	T	G	2: 155,702,585	D415A	probably damaging	Het
Eml6	A	G	11: 29,831,219		probably benign	Het
Ercc5	T	C	1: 44,164,019	F272S	probably damaging	Het
Fcamr	C	T	1: 130,811,487	R175C	probably damaging	Het
Frem3	G	A	8: 80,615,322	V1415I	probably benign	Het
Fry	T	C	5: 150,403,432		probably benign	Het
Gm14443	A	T	2: 175,171,590		probably benign	Het
Itih2	T	A	2: 10,097,924	T800S	probably benign	Het
Lgals9	G	A	11: 78,976,617	Q42*	probably null	Het
Lrrk2	A	G	15: 91,699,895	N286S	probably damaging	Het
Mefv	A	G	16: 3,708,534		probably benign	Het
Mkx	T	A	18: 6,937,192	D284V	probably benign	Het
Olfr743	T	A	14: 50,534,195	I261K	probably benign	Het
Pde1b	T	G	15: 103,526,273	S339A	possibly damaging	Het
Plch2	C	T	4: 154,989,799	V765M	probably damaging	Het
Ppp4r3b	A	T	11: 29,173,358	Q18L	probably benign	Het
Psme4	T	A	11: 30,807,687		probably null	Het
Pwp1	G	A	10: 85,879,309	D220N	probably damaging	Het
Rel	G	A	11: 23,757,010	T64I	probably damaging	Het
Rho	C	G	6: 115,935,605	N160K	probably damaging	Het
Skiv2l2	A	C	13: 112,883,251	L775*	probably null	Het
Sntb2	A	G	8: 107,001,577	T386A	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Ttc30a2	A	T	2: 75,976,332	V612D	probably benign	Het
Vcp	T	C	4: 42,988,728	T249A	possibly damaging	Het
Vmn1r167	A	G	7: 23,505,123	F156S	probably benign	Het
Vrk2	G	A	11: 26,535,522		probably benign	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp638	A	G	6: 83,929,041	N63D	probably damaging	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87813674	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87813808	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87800792	nonsense	probably null
IGL01755:Insrr	APN	3	87814186	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87811620	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87800722	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87809909	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87813127	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87809412	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87804498	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87813817	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87813061	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87809572	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87810517	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87814191	nonsense	probably null
IGL03073:Insrr	APN	3	87809938	splice site	probably benign
IGL03178:Insrr	APN	3	87802541	intron	probably null
IGL03389:Insrr	APN	3	87808731	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87809331	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87813581	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87809616	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0357:Insrr	UTSW	3	87808646	intron	probably null
R0501:Insrr	UTSW	3	87810684	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87813156	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87800872	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87814437	splice site	probably benign
R0558:Insrr	UTSW	3	87810981	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87813133	missense	probably damaging	0.97
R1694:Insrr	UTSW	3	87804062	missense	probably benign
R1785:Insrr	UTSW	3	87810572	splice site	probably null
R1786:Insrr	UTSW	3	87810572	splice site	probably null
R1892:Insrr	UTSW	3	87813877	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87814513	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87814291	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87803181	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87810572	splice site	probably null
R2131:Insrr	UTSW	3	87810572	splice site	probably null
R2133:Insrr	UTSW	3	87810572	splice site	probably null
R2220:Insrr	UTSW	3	87809418	missense	probably damaging	1.00
R2259:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87802667	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87809599	missense	probably benign
R4042:Insrr	UTSW	3	87813827	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4511:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87800887	missense	probably benign
R4870:Insrr	UTSW	3	87811604	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87815265	missense	probably benign	0.00
R5393:Insrr	UTSW	3	87810700	intron	probably null
R5685:Insrr	UTSW	3	87800496	intron	probably null
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87804176	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87800519	nonsense	probably null
R6298:Insrr	UTSW	3	87812965	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6728:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6796:Insrr	UTSW	3	87813566	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGCTCTTGGTCTGCACTGTATTC -3'
(R):5'- GGCAAAGTTCCTGGTTCTTCTCCAC -3'

Sequencing Primer
(F):5'- GGTCTGCACTGTATTCATTTGTC -3'
(R):5'- CTTCTCCACACGCACGG -3'

Posted On

2014-02-18