Incidental Mutation 'R1312:Cdh15'
ID157967
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Namecadherin 15
SynonymsM cadherin, Mcad, Cdh14
MMRRC Submission 039378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1312 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122847966-122867397 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 122861449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000034443
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 85.7%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
Acot10 A G 15: 20,666,499 V52A probably benign Het
Arhgap32 T C 9: 32,255,312 V415A probably benign Het
Cacna2d3 T C 14: 29,045,668 D750G probably benign Het
Dusp27 A T 1: 166,099,291 N917K possibly damaging Het
Edem2 T G 2: 155,702,585 D415A probably damaging Het
Eml6 A G 11: 29,831,219 probably benign Het
Ercc5 T C 1: 44,164,019 F272S probably damaging Het
Fcamr C T 1: 130,811,487 R175C probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gm14443 A T 2: 175,171,590 probably benign Het
Insrr A G 3: 87,800,490 T80A probably damaging Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Lgals9 G A 11: 78,976,617 Q42* probably null Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mefv A G 16: 3,708,534 probably benign Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Olfr743 T A 14: 50,534,195 I261K probably benign Het
Pde1b T G 15: 103,526,273 S339A possibly damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Rho C G 6: 115,935,605 N160K probably damaging Het
Skiv2l2 A C 13: 112,883,251 L775* probably null Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 122865323 intron probably benign
IGL01958:Cdh15 APN 8 122859350 missense probably damaging 1.00
IGL02588:Cdh15 APN 8 122856552 nonsense probably null
IGL02793:Cdh15 APN 8 122860982 missense probably damaging 1.00
IGL02947:Cdh15 APN 8 122865372 missense probably benign 0.00
R0310:Cdh15 UTSW 8 122865436 missense probably damaging 1.00
R0441:Cdh15 UTSW 8 122860966 missense probably damaging 1.00
R0766:Cdh15 UTSW 8 122861449 intron probably benign
R0898:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1023:Cdh15 UTSW 8 122865200 missense probably damaging 0.98
R1054:Cdh15 UTSW 8 122864337 missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R1081:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1101:Cdh15 UTSW 8 122860846 missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1208:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1209:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1210:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1317:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1318:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1393:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1428:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1429:Cdh15 UTSW 8 122857495 missense probably damaging 1.00
R1695:Cdh15 UTSW 8 122862016 missense probably benign 0.05
R2157:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2170:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2178:Cdh15 UTSW 8 122864976 splice site probably null
R2252:Cdh15 UTSW 8 122857422 missense probably damaging 1.00
R2290:Cdh15 UTSW 8 122859317 missense probably damaging 1.00
R2317:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2330:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2345:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2349:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2353:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2354:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2566:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2567:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2568:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2893:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2894:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R2937:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2938:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2990:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2992:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R2993:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3029:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3030:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3195:Cdh15 UTSW 8 122856635 missense probably benign 0.10
R3441:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3442:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3608:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R3686:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4119:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4120:Cdh15 UTSW 8 122863423 missense probably damaging 1.00
R4477:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4478:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4480:Cdh15 UTSW 8 122864676 missense probably benign 0.00
R4580:Cdh15 UTSW 8 122865158 missense probably damaging 0.99
R4583:Cdh15 UTSW 8 122865028 missense probably damaging 0.98
R4619:Cdh15 UTSW 8 122860873 missense probably damaging 1.00
R4694:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R4731:Cdh15 UTSW 8 122862024 missense probably damaging 1.00
R5076:Cdh15 UTSW 8 122864348 missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 122862063 missense probably null 1.00
R5375:Cdh15 UTSW 8 122865100 missense probably damaging 1.00
R5498:Cdh15 UTSW 8 122865178 missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 122856587 missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 122864347 missense probably benign 0.01
R6570:Cdh15 UTSW 8 122857391 missense probably damaging 1.00
R6708:Cdh15 UTSW 8 122863555 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ATCAGCCAGGAATCTGCTTCCCAC -3'
(R):5'- TGCTCTTCTCTAAGGGACCTCACAC -3'

Sequencing Primer
(F):5'- ACTGCCGCTAATGTCTGAC -3'
(R):5'- AGAGTCCCCTCTCAGAGC -3'
Posted On2014-02-18