Incidental Mutation 'R1313:Psapl1'
ID157992
Institutional Source Beutler Lab
Gene Symbol Psapl1
Ensembl Gene ENSMUSG00000043430
Gene Nameprosaposin-like 1
Synonyms2310020A21Rik
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36204021-36206568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36205266 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 401 (Q401K)
Ref Sequence ENSEMBL: ENSMUSP00000100594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000052224] [ENSMUST00000070720] [ENSMUST00000135324]
Predicted Effect probably benign
Transcript: ENSMUST00000037370
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052224
AA Change: Q401K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000100594
Gene: ENSMUSG00000043430
AA Change: Q401K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SAPA 25 58 1.19e-12 SMART
SapB 65 143 9.63e-7 SMART
SapB 188 260 8.51e-8 SMART
SapB 296 370 9.82e-22 SMART
SapB 398 473 8.37e-16 SMART
SAPA 482 515 2.01e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070720
SMART Domains Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
Blast:VPS10 170 213 2e-22 BLAST
low complexity region 214 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135324
SMART Domains Protein: ENSMUSP00000123543
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
SCOP:d1eur__ 1 111 2e-3 SMART
Blast:VPS10 1 173 1e-126 BLAST
PDB:4N7E|A 6 117 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141508
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.4%
  • 20x: 77.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the glycoprotein prosaposin. Based on sequence similarity between the encoded protein and prosaposin, it is predicted that the encoded protein is a preproprotein that is proteolytically processed to generate multiple protein products. These predicted products include saposins A-like, B-like, C-like, and D-like, which may play a role in the lysosomal degradation of sphingolipids. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Gatb A G 3: 85,653,826 I550V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilr4b C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Other mutations in Psapl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Psapl1 APN 5 36205631 missense probably benign
IGL01873:Psapl1 APN 5 36205225 missense possibly damaging 0.66
IGL02590:Psapl1 APN 5 36205053 missense probably benign
IGL02931:Psapl1 APN 5 36204889 missense probably damaging 1.00
R0138:Psapl1 UTSW 5 36204631 missense probably damaging 0.98
R0570:Psapl1 UTSW 5 36204280 missense possibly damaging 0.89
R1313:Psapl1 UTSW 5 36205266 missense probably benign 0.01
R2207:Psapl1 UTSW 5 36205165 missense probably damaging 1.00
R2247:Psapl1 UTSW 5 36205066 missense probably benign 0.01
R4792:Psapl1 UTSW 5 36205203 missense probably benign
R4865:Psapl1 UTSW 5 36204867 missense probably damaging 1.00
R5101:Psapl1 UTSW 5 36204150 missense probably damaging 1.00
R5947:Psapl1 UTSW 5 36204307 missense probably benign 0.08
R6015:Psapl1 UTSW 5 36204250 missense probably benign 0.00
R6751:Psapl1 UTSW 5 36204959 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCTCATGTCCAAAGTCACCC -3'
(R):5'- GACGCACTGATCTGTGCCTAGAAG -3'

Sequencing Primer
(F):5'- TCACCCCAGAGAAAGTATGTG -3'
(R):5'- GTTCATCATGAACTTGAGGCTC -3'
Posted On2014-02-18