Incidental Mutation 'R1313:Hnrnpul1'
ID157993
Institutional Source Beutler Lab
Gene Symbol Hnrnpul1
Ensembl Gene ENSMUSG00000040725
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 1
SynonymsE1B-AP5, E130317O14Rik, E1BAP5, Hnrpul1, Hnrnpul
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location25721165-25754757 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 25722916 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002683] [ENSMUST00000043765] [ENSMUST00000125699] [ENSMUST00000206832]
Predicted Effect probably benign
Transcript: ENSMUST00000002683
SMART Domains Protein: ENSMUSP00000002683
Gene: ENSMUSG00000002608

DomainStartEndE-ValueType
Pfam:DUF2052 156 327 4.1e-54 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000043765
AA Change: P685T
SMART Domains Protein: ENSMUSP00000037268
Gene: ENSMUSG00000040725
AA Change: P685T

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
SPRY 255 388 8.49e-41 SMART
Pfam:AAA_33 424 569 1.4e-29 PFAM
low complexity region 613 626 N/A INTRINSIC
low complexity region 631 693 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 745 765 N/A INTRINSIC
low complexity region 768 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156365
Predicted Effect unknown
Transcript: ENSMUST00000206832
AA Change: P785T
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.4%
  • 20x: 77.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus early-1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by early-1B-55kDa in adenovirus-infected cells. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Gatb A G 3: 85,653,826 I550V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilr4b C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Other mutations in Hnrnpul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hnrnpul1 APN 7 25726154 missense possibly damaging 0.74
IGL01287:Hnrnpul1 APN 7 25726898 missense probably damaging 1.00
IGL01409:Hnrnpul1 APN 7 25724652 missense unknown
IGL02026:Hnrnpul1 APN 7 25745162 missense probably damaging 0.99
IGL02073:Hnrnpul1 APN 7 25722341 unclassified probably benign
IGL02474:Hnrnpul1 APN 7 25726757 missense probably benign 0.02
IGL02839:Hnrnpul1 APN 7 25733242 critical splice donor site probably null
IGL02894:Hnrnpul1 APN 7 25750904 missense possibly damaging 0.70
IGL03382:Hnrnpul1 APN 7 25750984 start codon destroyed probably null 0.53
R0011:Hnrnpul1 UTSW 7 25742915 splice site probably benign
R0525:Hnrnpul1 UTSW 7 25740883 missense possibly damaging 0.72
R0587:Hnrnpul1 UTSW 7 25745232 missense possibly damaging 0.70
R1121:Hnrnpul1 UTSW 7 25740907 missense possibly damaging 0.68
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1880:Hnrnpul1 UTSW 7 25733098 missense possibly damaging 0.95
R1892:Hnrnpul1 UTSW 7 25726766 missense probably benign 0.11
R2113:Hnrnpul1 UTSW 7 25733269 missense possibly damaging 0.47
R2194:Hnrnpul1 UTSW 7 25725922 critical splice donor site probably null
R2269:Hnrnpul1 UTSW 7 25750874 missense probably damaging 0.98
R2679:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R3079:Hnrnpul1 UTSW 7 25733115 nonsense probably null
R3917:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4077:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4079:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4181:Hnrnpul1 UTSW 7 25726812 missense probably damaging 0.98
R4449:Hnrnpul1 UTSW 7 25722284 unclassified probably benign
R4707:Hnrnpul1 UTSW 7 25726833 missense probably damaging 1.00
R4764:Hnrnpul1 UTSW 7 25743011 missense probably benign 0.00
R5040:Hnrnpul1 UTSW 7 25742989 missense possibly damaging 0.86
R5131:Hnrnpul1 UTSW 7 25726794 missense probably benign 0.08
R5224:Hnrnpul1 UTSW 7 25745175 missense probably damaging 0.98
R5599:Hnrnpul1 UTSW 7 25754672 start gained probably benign
R5975:Hnrnpul1 UTSW 7 25754359 missense possibly damaging 0.93
R7032:Hnrnpul1 UTSW 7 25750894 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGGCTACACATCGGCCATTAAAGAC -3'
(R):5'- TGCACTTTAGAACAGACTTGCCTCC -3'

Sequencing Primer
(F):5'- GACCAGTTTATCAAAAGCCTGAG -3'
(R):5'- TCCATCCAGGAACCTGTGTG -3'
Posted On2014-02-18