Incidental Mutation 'R1313:Olfr473'
ID157994
Institutional Source Beutler Lab
Gene Symbol Olfr473
Ensembl Gene ENSMUSG00000095212
Gene Nameolfactory receptor 473
SynonymsGA_x6K02T2PBJ9-10262759-10263691, MOR204-4
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107930446-107935661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107933768 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 83 (M83L)
Ref Sequence ENSEMBL: ENSMUSP00000150610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084761] [ENSMUST00000217618]
Predicted Effect probably benign
Transcript: ENSMUST00000084761
AA Change: M83L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000081816
Gene: ENSMUSG00000095212
AA Change: M83L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.4e-49 PFAM
Pfam:7tm_1 41 290 1.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210626
AA Change: M83L
Predicted Effect probably benign
Transcript: ENSMUST00000217618
AA Change: M83L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.4%
  • 20x: 77.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Gatb A G 3: 85,653,826 I550V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilr4b C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Other mutations in Olfr473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Olfr473 APN 7 107934277 nonsense probably null
IGL02361:Olfr473 APN 7 107934277 nonsense probably null
IGL03228:Olfr473 APN 7 107934123 missense possibly damaging 0.94
R0255:Olfr473 UTSW 7 107934168 missense probably damaging 0.96
R0306:Olfr473 UTSW 7 107933700 missense probably damaging 1.00
R1126:Olfr473 UTSW 7 107934371 missense possibly damaging 0.76
R1313:Olfr473 UTSW 7 107933768 missense probably benign 0.01
R1860:Olfr473 UTSW 7 107934390 missense probably damaging 1.00
R2060:Olfr473 UTSW 7 107933661 missense probably benign 0.00
R2386:Olfr473 UTSW 7 107934273 missense probably damaging 0.99
R4324:Olfr473 UTSW 7 107933693 missense probably damaging 1.00
R4847:Olfr473 UTSW 7 107933827 nonsense probably null
R5926:Olfr473 UTSW 7 107933903 missense probably damaging 0.98
R6964:Olfr473 UTSW 7 107933759 missense probably benign 0.00
X0063:Olfr473 UTSW 7 107934345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGCTGAAAACCATACCACG -3'
(R):5'- ACTGTCACCACAATAATGGAGCCAG -3'

Sequencing Primer
(F):5'- GCAGAGCTAATCATCTTGGGAC -3'
(R):5'- TCCAATAATGGAGACATCTGAGC -3'
Posted On2014-02-18