Incidental Mutation 'R1313:Ankle1'
ID157995
Institutional Source Beutler Lab
Gene Symbol Ankle1
Ensembl Gene ENSMUSG00000046295
Gene Nameankyrin repeat and LEM domain containing 1
Synonyms8430438L13Rik, Ankrd41
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71406010-71409904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71407213 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 145 (E145G)
Ref Sequence ENSEMBL: ENSMUSP00000113162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002473] [ENSMUST00000119976] [ENSMUST00000120725]
Predicted Effect probably benign
Transcript: ENSMUST00000002473
SMART Domains Protein: ENSMUSP00000002473
Gene: ENSMUSG00000031820

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119976
AA Change: E145G

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113162
Gene: ENSMUSG00000046295
AA Change: E145G

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 177 193 N/A INTRINSIC
Pfam:LEM 282 319 4.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120725
SMART Domains Protein: ENSMUSP00000112797
Gene: ENSMUSG00000046295

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 157 173 N/A INTRINSIC
Pfam:LEM 261 300 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212383
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.4%
  • 20x: 77.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes no overt phenotype or detectable defects in hematopoiesis. Mouse embryonic fibroblasts do not show an impaired DNA damage response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Gatb A G 3: 85,653,826 I550V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilr4b C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Other mutations in Ankle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Ankle1 APN 8 71406259 missense probably damaging 1.00
IGL02558:Ankle1 APN 8 71408992 missense probably damaging 1.00
IGL02938:Ankle1 APN 8 71406252 missense probably damaging 1.00
R0358:Ankle1 UTSW 8 71407545 missense probably damaging 1.00
R1313:Ankle1 UTSW 8 71407213 missense possibly damaging 0.61
R1681:Ankle1 UTSW 8 71407618 missense probably benign 0.00
R1776:Ankle1 UTSW 8 71409274 missense probably damaging 0.99
R2070:Ankle1 UTSW 8 71409344 missense probably damaging 1.00
R2073:Ankle1 UTSW 8 71409329 missense possibly damaging 0.94
R2116:Ankle1 UTSW 8 71407918 missense probably benign 0.13
R2117:Ankle1 UTSW 8 71407918 missense probably benign 0.13
R4610:Ankle1 UTSW 8 71407207 intron probably benign
R5027:Ankle1 UTSW 8 71408979 missense probably damaging 1.00
R7051:Ankle1 UTSW 8 71407743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCCAGTTCTGTTTGTACATCTATCG -3'
(R):5'- AGTGTAGCCAGACTCTGAATACCACC -3'

Sequencing Primer
(F):5'- GTACATCTATCGTGTCAATCACTATC -3'
(R):5'- TTGCAGTCAATGTCAGGACC -3'
Posted On2014-02-18