Incidental Mutation 'R1313:Ddi1'
ID157997
Institutional Source Beutler Lab
Gene Symbol Ddi1
Ensembl Gene ENSMUSG00000047619
Gene NameDNA-damage inducible 1
Synonyms
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location6262733-6269846 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6265769 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 200 (E200G)
Ref Sequence ENSEMBL: ENSMUSP00000053223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051706] [ENSMUST00000058692] [ENSMUST00000168039] [ENSMUST00000214892]
PDB Structure
Solution Structure of the Ubiquitin-like Domain from Mouse Hypothetical 1700011N24Rik Protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000051706
AA Change: E200G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053223
Gene: ENSMUSG00000047619
AA Change: E200G

DomainStartEndE-ValueType
UBQ 3 77 4.57e-1 SMART
low complexity region 111 123 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Asp_protease 226 349 3.3e-63 PFAM
Pfam:RVP_2 229 362 3.6e-8 PFAM
Pfam:RVP 250 349 2.5e-8 PFAM
Pfam:Asp_protease_2 252 340 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058692
SMART Domains Protein: ENSMUSP00000056240
Gene: ENSMUSG00000032006

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 48 164 5.38e-25 SMART
PDGF 265 358 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168039
SMART Domains Protein: ENSMUSP00000128388
Gene: ENSMUSG00000032006

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 54 170 5.38e-25 SMART
PDGF 271 364 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214892
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.4%
  • 20x: 77.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Gatb A G 3: 85,653,826 I550V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Lilr4b C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Other mutations in Ddi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Ddi1 APN 9 6265773 missense probably damaging 0.97
IGL01977:Ddi1 APN 9 6266226 missense probably benign 0.01
IGL02260:Ddi1 APN 9 6265760 missense probably benign
IGL02543:Ddi1 APN 9 6266183 missense possibly damaging 0.79
IGL02678:Ddi1 APN 9 6266106 missense probably benign
R0482:Ddi1 UTSW 9 6266144 missense probably damaging 0.96
R1313:Ddi1 UTSW 9 6265769 missense probably damaging 0.99
R1588:Ddi1 UTSW 9 6265391 missense probably damaging 0.98
R1605:Ddi1 UTSW 9 6266012 missense probably benign 0.02
R1671:Ddi1 UTSW 9 6266225 missense possibly damaging 0.81
R4237:Ddi1 UTSW 9 6265799 missense probably benign 0.00
R4239:Ddi1 UTSW 9 6265799 missense probably benign 0.00
R4240:Ddi1 UTSW 9 6265799 missense probably benign 0.00
R4588:Ddi1 UTSW 9 6266003 missense probably benign 0.15
R4790:Ddi1 UTSW 9 6265761 missense probably benign 0.00
R4950:Ddi1 UTSW 9 6266073 missense probably benign 0.04
R5626:Ddi1 UTSW 9 6266003 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAACGCGGCCCATAATCCTC -3'
(R):5'- GACCTTTGCTCAGGAACTCGACAG -3'

Sequencing Primer
(F):5'- CATGATAGTCATCTGGGCACC -3'
(R):5'- AGGAACTCGACAGCCCTG -3'
Posted On2014-02-18