Incidental Mutation 'R1313:Lilr4b'
ID157998
Institutional Source Beutler Lab
Gene Symbol Lilr4b
Ensembl Gene ENSMUSG00000112023
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4B
SynonymsGp49a, gp49
MMRRC Submission 039379-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1313 (G1)
Quality Score150
Status Not validated
Chromosome10
Chromosomal Location51480632-51486703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 51480736 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 6 (T6I)
Ref Sequence ENSEMBL: ENSMUSP00000099958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102894] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218704] [ENSMUST00000219661] [ENSMUST00000219696] [ENSMUST00000219960]
Predicted Effect probably benign
Transcript: ENSMUST00000102894
AA Change: T6I

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099958
Gene: ENSMUSG00000112023
AA Change: T6I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCOP:d1nkr_2 24 118 3e-14 SMART
Blast:IG_like 28 118 5e-49 BLAST
Pfam:Ig_3 123 200 6.5e-8 PFAM
Pfam:Ig_2 123 218 5.9e-8 PFAM
Pfam:ig 127 211 8.4e-9 PFAM
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105481
AA Change: T6I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101121
Gene: ENSMUSG00000062593
AA Change: T6I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105482
AA Change: T6I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101122
Gene: ENSMUSG00000062593
AA Change: T6I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139982
Predicted Effect probably benign
Transcript: ENSMUST00000217706
AA Change: T6I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000218123
AA Change: T6I

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218649
Predicted Effect unknown
Transcript: ENSMUST00000218704
AA Change: T6I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219598
Predicted Effect probably benign
Transcript: ENSMUST00000219661
AA Change: T6I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000219696
AA Change: T6I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219717
Predicted Effect unknown
Transcript: ENSMUST00000219960
AA Change: T6I
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 91.4%
  • 20x: 77.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Gatb A G 3: 85,653,826 I550V probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Ints1 T C 5: 139,762,906 T1049A probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Other mutations in Lilr4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Lilr4b APN 10 51481251 missense probably benign 0.00
IGL02457:Lilr4b APN 10 51481238 missense probably benign 0.04
IGL03221:Lilr4b APN 10 51481428 splice site probably benign
IGL03396:Lilr4b APN 10 51481157 missense possibly damaging 0.71
R0145:Lilr4b UTSW 10 51484518 missense probably benign 0.00
R0336:Lilr4b UTSW 10 51481293 missense probably benign 0.28
R1543:Lilr4b UTSW 10 51481421 missense probably damaging 0.98
R1984:Lilr4b UTSW 10 51481735 missense possibly damaging 0.68
R1985:Lilr4b UTSW 10 51481735 missense possibly damaging 0.68
R2243:Lilr4b UTSW 10 51481608 missense possibly damaging 0.88
R4094:Lilr4b UTSW 10 51481410 missense probably damaging 0.99
R4887:Lilr4b UTSW 10 51484520 missense possibly damaging 0.81
R5588:Lilr4b UTSW 10 51481326 missense probably benign
R6404:Lilr4b UTSW 10 51485729 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGTTTACGCAGTCATCTGCTCTTAG -3'
(R):5'- GGTGTCCTGTGAAGAAATCAAAAGCCC -3'

Sequencing Primer
(F):5'- CTTAGGAAATTACAGAGGTTTCCC -3'
(R):5'- AACCTGGCTGTCGAATAGGT -3'
Posted On2014-02-18