Incidental Mutation 'R1294:Cfap57'
ID158012
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Namecilia and flagella associated protein 57
SynonymsWdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission 039360-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1294 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118554551-118620777 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 118606534 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
Predicted Effect probably null
Transcript: ENSMUST00000071972
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081921
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Meta Mutation Damage Score 0.54 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik T A 16: 36,257,252 D58E probably damaging Het
C2cd2 A G 16: 97,922,269 L16P probably damaging Het
Cnn2 A G 10: 79,993,525 D163G probably damaging Het
Csmd1 T C 8: 16,698,036 D233G probably damaging Het
Dhh T C 15: 98,894,383 Q248R probably benign Het
Elavl2 G A 4: 91,311,589 A19V probably benign Het
Fxr1 T A 3: 34,047,052 M169K probably benign Het
Ghr A G 15: 3,388,646 probably null Het
Gm5334 T C 7: 68,619,114 S94P probably damaging Het
Hrasls5 A G 19: 7,614,650 probably benign Het
Klk1b3 C A 7: 44,200,296 S35Y probably damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lap3 T C 5: 45,498,521 V156A probably benign Het
Pcbp3 A G 10: 76,763,321 I327T probably damaging Het
Polr1a A T 6: 71,912,902 N35I probably damaging Het
Rab3c T C 13: 110,260,565 T56A possibly damaging Het
Rapsn A T 2: 91,036,775 K141* probably null Het
Rxrg G T 1: 167,613,901 A83S probably benign Het
Serpinc1 T C 1: 160,989,641 S102P probably damaging Het
Setd2 A G 9: 110,549,507 N797D probably benign Het
Skiv2l T C 17: 34,841,064 probably null Het
Slc24a1 A T 9: 64,936,013 V619E unknown Het
Slc25a20 A G 9: 108,677,639 M128V probably benign Het
Spam1 A G 6: 24,796,907 I286V probably benign Het
Tbc1d22a T A 15: 86,496,826 F479Y probably damaging Het
Tdrd1 A G 19: 56,848,776 probably null Het
Trim58 T A 11: 58,643,127 I169N probably benign Het
Vmn1r25 A G 6: 57,978,479 I275T possibly damaging Het
Zfp27 T A 7: 29,896,312 Y76F possibly damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense not run
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense not run
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense not run
R7412:Cfap57 UTSW 4 118614931 missense not run
R7414:Cfap57 UTSW 4 118614931 missense not run
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TAGGCAACGTCAAGGTGGCACTTC -3'
(R):5'- TGGGACCCTGACTGAGAATGACTG -3'

Sequencing Primer
(F):5'- AAGGTGGCACTTCCACTC -3'
(R):5'- AGAATGACTGATGCTTTTGTGCC -3'
Posted On2014-02-18