Incidental Mutation 'R1294:Tdrd1'
ID158035
Institutional Source Beutler Lab
Gene Symbol Tdrd1
Ensembl Gene ENSMUSG00000025081
Gene Nametudor domain containing 1
SynonymsMTR-1
MMRRC Submission 039360-MU
Accession Numbers

Genbank: NM_001002238

Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #R1294 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56826209-56870012 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 56848776 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078723] [ENSMUST00000111604] [ENSMUST00000111606] [ENSMUST00000121249]
Predicted Effect probably null
Transcript: ENSMUST00000078723
SMART Domains Protein: ENSMUSP00000077785
Gene: ENSMUSG00000025081

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111604
SMART Domains Protein: ENSMUSP00000107231
Gene: ENSMUSG00000025081

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111606
SMART Domains Protein: ENSMUSP00000107233
Gene: ENSMUSG00000025081

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121249
SMART Domains Protein: ENSMUSP00000112786
Gene: ENSMUSG00000025081

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 9.9e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Meta Mutation Damage Score 0.6136 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a tudor domain protein. Alternatively spliced transcript variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygous mice are sterile, displaying postnatal spermatogenic defects. Females are fertile. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik T A 16: 36,257,252 D58E probably damaging Het
C2cd2 A G 16: 97,922,269 L16P probably damaging Het
Cfap57 A T 4: 118,606,534 probably null Het
Cnn2 A G 10: 79,993,525 D163G probably damaging Het
Csmd1 T C 8: 16,698,036 D233G probably damaging Het
Dhh T C 15: 98,894,383 Q248R probably benign Het
Elavl2 G A 4: 91,311,589 A19V probably benign Het
Fxr1 T A 3: 34,047,052 M169K probably benign Het
Ghr A G 15: 3,388,646 probably null Het
Gm5334 T C 7: 68,619,114 S94P probably damaging Het
Hrasls5 A G 19: 7,614,650 probably benign Het
Klk1b3 C A 7: 44,200,296 S35Y probably damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lap3 T C 5: 45,498,521 V156A probably benign Het
Pcbp3 A G 10: 76,763,321 I327T probably damaging Het
Polr1a A T 6: 71,912,902 N35I probably damaging Het
Rab3c T C 13: 110,260,565 T56A possibly damaging Het
Rapsn A T 2: 91,036,775 K141* probably null Het
Rxrg G T 1: 167,613,901 A83S probably benign Het
Serpinc1 T C 1: 160,989,641 S102P probably damaging Het
Setd2 A G 9: 110,549,507 N797D probably benign Het
Skiv2l T C 17: 34,841,064 probably null Het
Slc24a1 A T 9: 64,936,013 V619E unknown Het
Slc25a20 A G 9: 108,677,639 M128V probably benign Het
Spam1 A G 6: 24,796,907 I286V probably benign Het
Tbc1d22a T A 15: 86,496,826 F479Y probably damaging Het
Trim58 T A 11: 58,643,127 I169N probably benign Het
Vmn1r25 A G 6: 57,978,479 I275T possibly damaging Het
Zfp27 T A 7: 29,896,312 Y76F possibly damaging Het
Other mutations in Tdrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tdrd1 APN 19 56851464 missense possibly damaging 0.51
IGL01366:Tdrd1 APN 19 56855302 missense probably benign 0.00
IGL01569:Tdrd1 APN 19 56834409 missense probably damaging 1.00
IGL02691:Tdrd1 APN 19 56843852 missense probably damaging 0.99
3-1:Tdrd1 UTSW 19 56861695 missense probably benign
R0081:Tdrd1 UTSW 19 56831271 missense probably benign 0.16
R0139:Tdrd1 UTSW 19 56843198 missense probably benign 0.00
R0254:Tdrd1 UTSW 19 56842566 missense probably benign 0.02
R0686:Tdrd1 UTSW 19 56856051 missense probably damaging 1.00
R0735:Tdrd1 UTSW 19 56865978 nonsense probably null
R0740:Tdrd1 UTSW 19 56839099 missense probably damaging 1.00
R1241:Tdrd1 UTSW 19 56861760 missense probably benign
R1508:Tdrd1 UTSW 19 56851358 missense probably damaging 1.00
R1655:Tdrd1 UTSW 19 56843216 nonsense probably null
R1708:Tdrd1 UTSW 19 56842289 missense probably benign 0.13
R1796:Tdrd1 UTSW 19 56837783 missense probably damaging 0.98
R1840:Tdrd1 UTSW 19 56842312 missense probably damaging 1.00
R2138:Tdrd1 UTSW 19 56842589 missense probably benign 0.30
R2201:Tdrd1 UTSW 19 56858661 missense probably benign 0.14
R2201:Tdrd1 UTSW 19 56858662 missense probably benign 0.00
R2286:Tdrd1 UTSW 19 56839119 missense probably benign 0.05
R2443:Tdrd1 UTSW 19 56841354 missense probably null 0.01
R3001:Tdrd1 UTSW 19 56861750 nonsense probably null
R3002:Tdrd1 UTSW 19 56861750 nonsense probably null
R3418:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3419:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3707:Tdrd1 UTSW 19 56865993 missense possibly damaging 0.86
R3978:Tdrd1 UTSW 19 56866634 missense probably benign 0.01
R4077:Tdrd1 UTSW 19 56831073 missense probably benign 0.22
R4083:Tdrd1 UTSW 19 56843230 missense probably benign
R4193:Tdrd1 UTSW 19 56851341 nonsense probably null
R5882:Tdrd1 UTSW 19 56848939 missense probably damaging 1.00
R6073:Tdrd1 UTSW 19 56843223 nonsense probably null
R6223:Tdrd1 UTSW 19 56865850 missense probably damaging 1.00
R6240:Tdrd1 UTSW 19 56841335 missense probably benign 0.00
R6953:Tdrd1 UTSW 19 56831371 missense probably damaging 0.98
R7090:Tdrd1 UTSW 19 56851401 missense probably benign 0.28
X0020:Tdrd1 UTSW 19 56856060 missense probably damaging 1.00
X0053:Tdrd1 UTSW 19 56865791 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTCTGACAAGGTGCATTGGAGGAC -3'
(R):5'- ACTCAAGGCCAAGTGGGGCTATTC -3'

Sequencing Primer
(F):5'- CGTTGGAAGAGTGACAGTTGAG -3'
(R):5'- GTCCCCAATGGTTGGATAAAAGTC -3'
Posted On2014-02-18