Incidental Mutation 'R1295:Sele'
ID158040
Institutional Source Beutler Lab
Gene Symbol Sele
Ensembl Gene ENSMUSG00000026582
Gene Nameselectin, endothelial cell
SynonymsCD62E, E-selectin, Elam
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1295 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164048234-164057677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164050810 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 239 (S239R)
Ref Sequence ENSEMBL: ENSMUSP00000027874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027874]
Predicted Effect probably damaging
Transcript: ENSMUST00000027874
AA Change: S239R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582
AA Change: S239R

DomainStartEndE-ValueType
CLECT 21 146 1.45e-21 SMART
EGF 149 182 2.83e-5 SMART
CCP 187 245 1.49e-9 SMART
CCP 250 307 5.43e-12 SMART
CCP 312 370 1.82e-13 SMART
CCP 375 433 1.36e-12 SMART
CCP 438 496 6e-14 SMART
CCP 501 555 1.39e-9 SMART
transmembrane domain 565 587 N/A INTRINSIC
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Sele
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Sele APN 1 164051834 missense probably damaging 1.00
IGL02097:Sele APN 1 164053093 missense probably benign 0.02
IGL02243:Sele APN 1 164052968 missense probably benign 0.01
IGL02688:Sele APN 1 164050130 missense probably damaging 1.00
IGL03022:Sele APN 1 164054679 missense probably benign 0.01
R0433:Sele UTSW 1 164049244 missense possibly damaging 0.74
R0487:Sele UTSW 1 164053615 nonsense probably null
R0678:Sele UTSW 1 164054729 critical splice donor site probably null
R1296:Sele UTSW 1 164050810 missense probably damaging 1.00
R1532:Sele UTSW 1 164053851 missense probably benign 0.29
R1730:Sele UTSW 1 164054623 missense probably benign
R2102:Sele UTSW 1 164053826 missense probably damaging 1.00
R2384:Sele UTSW 1 164050775 missense probably benign 0.00
R3001:Sele UTSW 1 164053571 missense probably damaging 1.00
R3002:Sele UTSW 1 164053571 missense probably damaging 1.00
R5851:Sele UTSW 1 164049574 missense probably benign 0.06
R6164:Sele UTSW 1 164051817 splice site probably null
R6239:Sele UTSW 1 164050808 missense probably damaging 0.98
R6406:Sele UTSW 1 164050743 missense probably damaging 1.00
R6411:Sele UTSW 1 164049415 missense probably benign 0.03
R6731:Sele UTSW 1 164053673 missense probably damaging 1.00
R6851:Sele UTSW 1 164053952 missense probably damaging 1.00
X0005:Sele UTSW 1 164049343 missense probably damaging 1.00
X0021:Sele UTSW 1 164053611 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGGAACACCCTGACTATGGAAGCC -3'
(R):5'- TTGCCGTGCAAAGAGAAGCTCC -3'

Sequencing Primer
(F):5'- TATGGAAGCCTGAACTGCTC -3'
(R):5'- CTCAACAAGGTCCTATTGCATGG -3'
Posted On2014-02-18