Incidental Mutation 'R1295:Prodh2'
ID158059
Institutional Source Beutler Lab
Gene Symbol Prodh2
Ensembl Gene ENSMUSG00000036892
Gene Nameproline dehydrogenase (oxidase) 2
Synonyms2510028N04Rik, POX1, 2510038B11Rik, MmPOX1
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1295 (G1)
Quality Score184
Status Validated
Chromosome7
Chromosomal Location30493622-30513402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30494089 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 79 (V79A)
Ref Sequence ENSEMBL: ENSMUSP00000116662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058280] [ENSMUST00000130839] [ENSMUST00000131040] [ENSMUST00000133318] [ENSMUST00000142575]
Predicted Effect probably damaging
Transcript: ENSMUST00000058280
AA Change: V111A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062214
Gene: ENSMUSG00000036892
AA Change: V111A

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
Pfam:Pro_dh 87 440 3.4e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130839
AA Change: V111A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117480
Gene: ENSMUSG00000036892
AA Change: V111A

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131040
AA Change: V79A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116662
Gene: ENSMUSG00000036892
AA Change: V79A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
Pfam:Pro_dh 91 260 5e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131789
Predicted Effect probably damaging
Transcript: ENSMUST00000133318
AA Change: V109A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122546
Gene: ENSMUSG00000036892
AA Change: V109A

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142514
Predicted Effect silent
Transcript: ENSMUST00000142575
SMART Domains Protein: ENSMUSP00000114778
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Pfam:Pro_dh 147 284 6.5e-14 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the first step in the catabolism of trans-4-hydroxy-L-proline, an amino acid derivative obtained through food intake and collagen turnover. One of the downstream products of this catabolism is glyoxylate, which in people with disorders of glyoxalate metabolism can lead to an increase in oxalate levels and the formation of calcium-oxalate kidney stones. Therefore, this gene may serve as a therapeutic target against primary hyperoxalurias (PH). This gene is similar to proline dehydrogenase (oxidase) 1, a mitochondrial enzyme that catalyzes the first step in proline catabolism. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Prodh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Prodh2 APN 7 30511203 missense probably damaging 1.00
IGL01949:Prodh2 APN 7 30509765 critical splice acceptor site probably null
IGL02119:Prodh2 APN 7 30506504 missense probably damaging 1.00
IGL02334:Prodh2 APN 7 30506378 missense probably damaging 0.99
IGL03061:Prodh2 APN 7 30512833 nonsense probably null
R0831:Prodh2 UTSW 7 30494224 nonsense probably null
R0964:Prodh2 UTSW 7 30506281 missense probably damaging 1.00
R4414:Prodh2 UTSW 7 30506452 missense probably damaging 1.00
R5035:Prodh2 UTSW 7 30506479 missense possibly damaging 0.49
R5461:Prodh2 UTSW 7 30494523 missense possibly damaging 0.92
R5643:Prodh2 UTSW 7 30506746 missense possibly damaging 0.65
R6276:Prodh2 UTSW 7 30506651 missense probably benign 0.07
R6876:Prodh2 UTSW 7 30506500 missense probably damaging 1.00
X0026:Prodh2 UTSW 7 30493775 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTTTGGTCACTCATGGACTAGCGG -3'
(R):5'- AGGTTCTCCTCATACCAGACCTCAC -3'

Sequencing Primer
(F):5'- TCATGGACTAGCGGTGAGC -3'
(R):5'- CCAGACCTCACTGCCCG -3'
Posted On2014-02-18