Incidental Mutation 'R1295:Arhgef17'
ID158060
Institutional Source Beutler Lab
Gene Symbol Arhgef17
Ensembl Gene ENSMUSG00000032875
Gene NameRho guanine nucleotide exchange factor (GEF) 17
Synonyms
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R1295 (G1)
Quality Score170
Status Validated
Chromosome7
Chromosomal Location100869752-100932107 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 100881269 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 428 (E428*)
Ref Sequence ENSEMBL: ENSMUSP00000146564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107032] [ENSMUST00000209041]
Predicted Effect probably null
Transcript: ENSMUST00000107032
AA Change: E1437*
SMART Domains Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: E1437*

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
low complexity region 160 175 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 227 255 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 507 526 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
RhoGEF 1063 1246 9.56e-61 SMART
Blast:PH 1281 1466 4e-88 BLAST
low complexity region 1582 1595 N/A INTRINSIC
low complexity region 1630 1642 N/A INTRINSIC
low complexity region 1646 1657 N/A INTRINSIC
low complexity region 1661 1701 N/A INTRINSIC
low complexity region 1708 1719 N/A INTRINSIC
low complexity region 2033 2040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175555
Predicted Effect probably null
Transcript: ENSMUST00000208482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208735
Predicted Effect probably null
Transcript: ENSMUST00000209041
AA Change: E428*
Meta Mutation Damage Score 0.584 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Arhgef17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Arhgef17 APN 7 100929449 missense probably benign
IGL01071:Arhgef17 APN 7 100885700 missense probably damaging 0.99
IGL01882:Arhgef17 APN 7 100878580 nonsense probably null
IGL01995:Arhgef17 APN 7 100928655 missense probably benign 0.02
IGL02213:Arhgef17 APN 7 100890426 missense probably benign
IGL02380:Arhgef17 APN 7 100929443 missense possibly damaging 0.60
IGL02551:Arhgef17 APN 7 100930346 missense probably damaging 1.00
IGL02613:Arhgef17 APN 7 100928896 missense probably damaging 1.00
IGL02643:Arhgef17 APN 7 100883882 missense possibly damaging 0.95
IGL02798:Arhgef17 APN 7 100929626 missense probably benign 0.00
IGL03113:Arhgef17 APN 7 100929731 missense probably benign 0.00
IGL03264:Arhgef17 APN 7 100880013 missense probably benign 0.00
R0064:Arhgef17 UTSW 7 100881354 missense probably benign 0.00
R0189:Arhgef17 UTSW 7 100928850 missense probably damaging 1.00
R0482:Arhgef17 UTSW 7 100880621 missense probably damaging 1.00
R0826:Arhgef17 UTSW 7 100930743 missense probably benign 0.01
R1296:Arhgef17 UTSW 7 100881269 nonsense probably null
R1389:Arhgef17 UTSW 7 100931037 small deletion probably benign
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1513:Arhgef17 UTSW 7 100930862 missense probably benign
R1539:Arhgef17 UTSW 7 100890473 missense probably damaging 1.00
R1644:Arhgef17 UTSW 7 100929504 missense probably damaging 1.00
R1789:Arhgef17 UTSW 7 100929870 missense probably damaging 1.00
R1861:Arhgef17 UTSW 7 100882268 missense probably damaging 1.00
R1868:Arhgef17 UTSW 7 100878977 missense probably benign
R2009:Arhgef17 UTSW 7 100881781 missense probably damaging 0.98
R2095:Arhgef17 UTSW 7 100881263 missense probably damaging 1.00
R2311:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
R3607:Arhgef17 UTSW 7 100931172 missense probably damaging 1.00
R3882:Arhgef17 UTSW 7 100876454 missense possibly damaging 0.70
R4089:Arhgef17 UTSW 7 100883799 missense probably damaging 1.00
R4420:Arhgef17 UTSW 7 100882308 splice site probably benign
R4536:Arhgef17 UTSW 7 100929854 missense probably damaging 1.00
R4548:Arhgef17 UTSW 7 100931129 missense possibly damaging 0.60
R4616:Arhgef17 UTSW 7 100882485 missense probably damaging 1.00
R5040:Arhgef17 UTSW 7 100876825 missense probably benign 0.17
R5100:Arhgef17 UTSW 7 100881756 missense possibly damaging 0.90
R5233:Arhgef17 UTSW 7 100881369 missense possibly damaging 0.61
R5307:Arhgef17 UTSW 7 100929428 missense probably benign 0.00
R5313:Arhgef17 UTSW 7 100928924 missense probably damaging 0.99
R5643:Arhgef17 UTSW 7 100880011 missense probably damaging 1.00
R5704:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6166:Arhgef17 UTSW 7 100876492 missense probably damaging 1.00
R6417:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6420:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6510:Arhgef17 UTSW 7 100878536 missense probably damaging 0.97
R6877:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6888:Arhgef17 UTSW 7 100930820 missense possibly damaging 0.74
R7016:Arhgef17 UTSW 7 100878977 missense probably benign
R7073:Arhgef17 UTSW 7 100929991 nonsense probably null
X0012:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AATGTCCAGCCTGCTGCTTCAC -3'
(R):5'- GGGACAGACAGTCTTGGCTTTTGC -3'

Sequencing Primer
(F):5'- CTTCACTGTGGAAGTCTCAGG -3'
(R):5'- TTGCTCCCACTTAAGGGAAG -3'
Posted On2014-02-18