Incidental Mutation 'R1295:Muc6'
ID 158061
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Name mucin 6, gastric
Synonyms
MMRRC Submission 039361-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.095) question?
Stock # R1295 (G1)
Quality Score 224
Status Validated
Chromosome 7
Chromosomal Location 141213373-141241641 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141238144 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 112 (E112G)
Ref Sequence ENSEMBL: ENSMUSP00000140483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062451
AA Change: E112G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: E112G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
AA Change: E112G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191
AA Change: E112G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190907
AA Change: E112G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: E112G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,737,783 (GRCm39) S53G possibly damaging Het
Adgrb1 T A 15: 74,421,888 (GRCm39) L886Q probably damaging Het
Adprhl1 G A 8: 13,298,624 (GRCm39) T102M probably damaging Het
Akap6 A C 12: 52,933,812 (GRCm39) K435Q probably damaging Het
Aldh7a1 T C 18: 56,680,022 (GRCm39) probably null Het
Amfr T C 8: 94,701,432 (GRCm39) R507G probably benign Het
Ap1m1 T A 8: 73,005,719 (GRCm39) probably null Het
Arhgap29 A G 3: 121,786,044 (GRCm39) H275R probably benign Het
Arhgef17 C A 7: 100,530,476 (GRCm39) E428* probably null Het
Atm A T 9: 53,367,830 (GRCm39) V2431E probably damaging Het
Atn1 G T 6: 124,724,750 (GRCm39) P161Q unknown Het
Atp13a2 T C 4: 140,721,113 (GRCm39) S99P probably damaging Het
Ccar1 C A 10: 62,619,661 (GRCm39) probably null Het
Cdk18 T C 1: 132,047,698 (GRCm39) probably benign Het
Cep85 A G 4: 133,894,711 (GRCm39) W32R probably damaging Het
Col5a3 A G 9: 20,719,714 (GRCm39) F215S unknown Het
Decr1 T C 4: 15,919,207 (GRCm39) N312S possibly damaging Het
Diaph3 A T 14: 87,244,835 (GRCm39) W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 (GRCm39) probably benign Het
Ehd3 C A 17: 74,135,181 (GRCm39) D352E probably damaging Het
Enpp6 T G 8: 47,518,535 (GRCm39) I221S probably benign Het
Fam186a T C 15: 99,837,670 (GRCm39) probably benign Het
Gm5435 G T 12: 82,542,558 (GRCm39) noncoding transcript Het
Gpr22 A C 12: 31,759,513 (GRCm39) I203S probably benign Het
Gpr61 A G 3: 108,057,797 (GRCm39) V288A possibly damaging Het
Grik3 G A 4: 125,598,357 (GRCm39) probably benign Het
Gstcd T C 3: 132,711,389 (GRCm39) N431D probably damaging Het
H1f5 T C 13: 21,964,169 (GRCm39) S186G probably benign Het
Haao T A 17: 84,146,267 (GRCm39) Q69L probably benign Het
Ift140 G T 17: 25,307,907 (GRCm39) probably null Het
Ikbke A G 1: 131,197,963 (GRCm39) V381A probably benign Het
Ing1 T A 8: 11,611,502 (GRCm39) I38N probably damaging Het
Ing1 A C 8: 11,611,501 (GRCm39) I38L probably benign Het
Itga4 A G 2: 79,153,033 (GRCm39) M907V possibly damaging Het
Kcnk12 C T 17: 88,053,801 (GRCm39) G287D probably damaging Het
Kmt2e A C 5: 23,707,402 (GRCm39) H1655P probably damaging Het
Mbtd1 A G 11: 93,801,185 (GRCm39) Y122C probably damaging Het
Mif-ps9 T A 19: 56,743,766 (GRCm39) noncoding transcript Het
Mslnl T C 17: 25,962,214 (GRCm39) L204P probably damaging Het
Nav3 T A 10: 109,527,963 (GRCm39) D2240V probably damaging Het
Ndufaf3 T C 9: 108,443,892 (GRCm39) T9A probably damaging Het
Numb C A 12: 83,842,935 (GRCm39) probably benign Het
Prodh2 T C 7: 30,193,514 (GRCm39) V79A probably damaging Het
Psmb2 A G 4: 126,580,825 (GRCm39) Y73C probably damaging Het
Rmnd5a G A 6: 71,375,439 (GRCm39) L80F probably benign Het
Rnf19a G T 15: 36,244,247 (GRCm39) Y604* probably null Het
Ros1 T A 10: 51,964,028 (GRCm39) E1744V possibly damaging Het
Rpusd2 T C 2: 118,867,408 (GRCm39) F219L probably benign Het
Sall2 T C 14: 52,551,182 (GRCm39) N671S probably damaging Het
Sele T A 1: 163,878,379 (GRCm39) S239R probably damaging Het
Serpina3b T C 12: 104,097,138 (GRCm39) F140L probably damaging Het
Stxbp1 A T 2: 32,684,648 (GRCm39) S594T probably benign Het
Sufu G A 19: 46,443,159 (GRCm39) probably benign Het
Tbx2 A G 11: 85,725,592 (GRCm39) E181G probably damaging Het
Thumpd2 A G 17: 81,363,317 (GRCm39) V50A probably damaging Het
Tlcd4 A G 3: 121,000,940 (GRCm39) V231A probably benign Het
Ttn C A 2: 76,573,589 (GRCm39) R17441L probably damaging Het
Usp34 A G 11: 23,334,477 (GRCm39) Y1157C probably damaging Het
Vmn1r9 T C 6: 57,048,522 (GRCm39) V199A probably damaging Het
Vmn2r6 A G 3: 64,445,694 (GRCm39) F677S probably damaging Het
Vmn2r84 C T 10: 130,225,008 (GRCm39) A501T probably benign Het
Wapl C T 14: 34,446,726 (GRCm39) P605S probably damaging Het
Zfp598 A G 17: 24,898,623 (GRCm39) N474S probably benign Het
Zfyve26 A G 12: 79,321,694 (GRCm39) L975P probably damaging Het
Zp3r C T 1: 130,519,181 (GRCm39) G255D probably damaging Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL00466:Muc6 APN 7 141,232,169 (GRCm39) missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141,638,890 (GRCm38) missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141,234,333 (GRCm39) nonsense probably null
IGL01021:Muc6 APN 7 141,217,075 (GRCm39) missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141,234,720 (GRCm39) missense probably damaging 1.00
IGL01294:Muc6 APN 7 141,232,926 (GRCm39) missense probably damaging 1.00
IGL01449:Muc6 APN 7 141,218,527 (GRCm39) missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141,237,572 (GRCm39) missense probably damaging 1.00
IGL01539:Muc6 APN 7 141,236,306 (GRCm39) missense probably benign 0.07
IGL01541:Muc6 APN 7 141,236,069 (GRCm39) nonsense probably null
IGL01810:Muc6 APN 7 141,237,327 (GRCm39) missense probably damaging 0.97
IGL01941:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL01954:Muc6 APN 7 141,218,497 (GRCm39) missense probably benign 0.06
IGL02096:Muc6 APN 7 141,226,117 (GRCm39) intron probably benign
IGL02192:Muc6 APN 7 141,217,717 (GRCm39) missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141,235,889 (GRCm39) missense probably damaging 1.00
IGL02234:Muc6 APN 7 141,226,842 (GRCm39) missense probably benign 0.09
IGL02302:Muc6 APN 7 141,227,763 (GRCm39) missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141,226,726 (GRCm39) missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141,216,853 (GRCm39) missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141,235,843 (GRCm39) splice site probably benign
IGL02851:Muc6 APN 7 141,234,627 (GRCm39) missense probably damaging 1.00
IGL03026:Muc6 APN 7 141,226,414 (GRCm39) intron probably benign
IGL03070:Muc6 APN 7 141,230,834 (GRCm39) splice site probably benign
IGL03108:Muc6 APN 7 141,217,402 (GRCm39) missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141,238,324 (GRCm39) missense probably damaging 1.00
IGL03366:Muc6 APN 7 141,234,349 (GRCm39) missense probably damaging 1.00
anticipation UTSW 7 141,214,363 (GRCm39) frame shift probably null
F5770:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R0153:Muc6 UTSW 7 141,214,029 (GRCm39) missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141,235,939 (GRCm39) missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141,216,868 (GRCm39) missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141,238,548 (GRCm39) missense probably benign 0.01
R0499:Muc6 UTSW 7 141,226,735 (GRCm39) missense probably benign
R0503:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141,218,497 (GRCm39) missense probably benign 0.06
R0792:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R0880:Muc6 UTSW 7 141,217,270 (GRCm39) missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141,230,500 (GRCm39) missense probably damaging 0.99
R1174:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1175:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R1189:Muc6 UTSW 7 141,232,122 (GRCm39) missense probably damaging 1.00
R1259:Muc6 UTSW 7 141,226,464 (GRCm39) intron probably benign
R1293:Muc6 UTSW 7 141,238,255 (GRCm39) missense probably damaging 1.00
R1296:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1471:Muc6 UTSW 7 141,234,176 (GRCm39) missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141,238,144 (GRCm39) missense probably benign 0.04
R1548:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R1548:Muc6 UTSW 7 141,238,368 (GRCm39) splice site probably benign
R1576:Muc6 UTSW 7 141,214,437 (GRCm39) missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141,234,265 (GRCm39) missense probably damaging 1.00
R1702:Muc6 UTSW 7 141,236,752 (GRCm39) missense probably damaging 1.00
R1792:Muc6 UTSW 7 141,214,371 (GRCm39) missense probably benign 0.41
R1924:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141,217,011 (GRCm39) missense probably damaging 0.99
R1964:Muc6 UTSW 7 141,226,330 (GRCm39) intron probably benign
R1964:Muc6 UTSW 7 141,226,329 (GRCm39) nonsense probably null
R1975:Muc6 UTSW 7 141,234,368 (GRCm39) missense probably damaging 1.00
R2031:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141,213,991 (GRCm39) missense probably benign 0.23
R2201:Muc6 UTSW 7 141,236,075 (GRCm39) missense probably damaging 1.00
R2218:Muc6 UTSW 7 141,233,227 (GRCm39) missense probably benign 0.41
R2245:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141,217,423 (GRCm39) missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141,217,837 (GRCm39) missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141,217,444 (GRCm39) missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141,226,651 (GRCm39) missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141,216,951 (GRCm39) missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141,234,946 (GRCm39) splice site probably benign
R3872:Muc6 UTSW 7 141,226,867 (GRCm39) missense probably benign
R4029:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141,234,920 (GRCm39) missense probably damaging 1.00
R4126:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141,217,576 (GRCm39) missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141,226,356 (GRCm39) intron probably benign
R4509:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141,230,489 (GRCm39) missense probably benign 0.03
R4594:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141,224,212 (GRCm39) intron probably benign
R4678:Muc6 UTSW 7 141,230,554 (GRCm39) missense probably benign 0.09
R4737:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R4737:Muc6 UTSW 7 141,226,426 (GRCm39) intron probably benign
R4981:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5012:Muc6 UTSW 7 141,216,570 (GRCm39) missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141,226,795 (GRCm39) missense probably benign
R5027:Muc6 UTSW 7 141,216,349 (GRCm39) missense probably benign 0.01
R5058:Muc6 UTSW 7 141,230,491 (GRCm39) missense probably benign 0.01
R5069:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5126:Muc6 UTSW 7 141,237,564 (GRCm39) missense probably damaging 1.00
R5168:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R5179:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141,237,375 (GRCm39) missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141,217,836 (GRCm39) missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141,235,078 (GRCm39) missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141,216,448 (GRCm39) missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141,235,850 (GRCm39) critical splice donor site probably null
R5800:Muc6 UTSW 7 141,226,690 (GRCm39) splice site probably benign
R5808:Muc6 UTSW 7 141,226,360 (GRCm39) intron probably benign
R5865:Muc6 UTSW 7 141,236,769 (GRCm39) missense probably damaging 0.97
R5919:Muc6 UTSW 7 141,227,837 (GRCm39) missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141,227,841 (GRCm39) missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141,234,640 (GRCm39) missense probably damaging 1.00
R6126:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141,226,792 (GRCm39) missense probably benign
R6236:Muc6 UTSW 7 141,218,685 (GRCm39) missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141,235,086 (GRCm39) missense probably damaging 1.00
R6254:Muc6 UTSW 7 141,237,380 (GRCm39) missense probably benign 0.09
R6418:Muc6 UTSW 7 141,224,032 (GRCm39) intron probably benign
R6609:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6610:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6611:Muc6 UTSW 7 141,226,700 (GRCm39) splice site probably benign
R6623:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6626:Muc6 UTSW 7 141,223,981 (GRCm39) intron probably benign
R6817:Muc6 UTSW 7 141,237,326 (GRCm39) missense probably damaging 0.99
R6923:Muc6 UTSW 7 141,217,453 (GRCm39) missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141,226,246 (GRCm39) intron probably benign
R7001:Muc6 UTSW 7 141,217,320 (GRCm39) missense probably damaging 0.99
R7046:Muc6 UTSW 7 141,226,456 (GRCm39) intron probably benign
R7097:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7099:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7101:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7107:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7108:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7112:Muc6 UTSW 7 141,235,542 (GRCm39) missense probably damaging 1.00
R7202:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7204:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7205:Muc6 UTSW 7 141,214,363 (GRCm39) frame shift probably null
R7222:Muc6 UTSW 7 141,214,428 (GRCm39) missense unknown
R7230:Muc6 UTSW 7 141,235,479 (GRCm39) missense probably damaging 1.00
R7278:Muc6 UTSW 7 141,226,842 (GRCm39) missense probably benign 0.09
R7483:Muc6 UTSW 7 141,224,245 (GRCm39) missense unknown
R7501:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7601:Muc6 UTSW 7 141,216,454 (GRCm39) missense unknown
R7641:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7644:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7645:Muc6 UTSW 7 141,234,923 (GRCm39) missense probably benign 0.40
R7659:Muc6 UTSW 7 141,216,973 (GRCm39) missense possibly damaging 0.53
R7674:Muc6 UTSW 7 141,224,247 (GRCm39) missense unknown
R7679:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7680:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7689:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7690:Muc6 UTSW 7 141,217,659 (GRCm39) missense probably damaging 0.98
R7760:Muc6 UTSW 7 141,237,322 (GRCm39) splice site probably null
R7806:Muc6 UTSW 7 141,217,387 (GRCm39) missense possibly damaging 0.53
R7809:Muc6 UTSW 7 141,226,638 (GRCm39) missense probably benign 0.02
R7848:Muc6 UTSW 7 141,232,188 (GRCm39) missense possibly damaging 0.53
R7859:Muc6 UTSW 7 141,231,687 (GRCm39) missense probably damaging 0.96
R8054:Muc6 UTSW 7 141,231,748 (GRCm39) missense probably damaging 1.00
R8085:Muc6 UTSW 7 141,226,729 (GRCm39) missense unknown
R8130:Muc6 UTSW 7 141,233,354 (GRCm39) missense probably damaging 0.97
R8210:Muc6 UTSW 7 141,235,673 (GRCm39) critical splice donor site probably null
R8273:Muc6 UTSW 7 141,226,795 (GRCm39) missense unknown
R8294:Muc6 UTSW 7 141,217,263 (GRCm39) missense possibly damaging 0.96
R8329:Muc6 UTSW 7 141,226,525 (GRCm39) missense unknown
R8379:Muc6 UTSW 7 141,230,579 (GRCm39) nonsense probably null
R8537:Muc6 UTSW 7 141,234,184 (GRCm39) missense probably benign 0.03
R8736:Muc6 UTSW 7 141,228,439 (GRCm39) missense possibly damaging 0.53
R8767:Muc6 UTSW 7 141,229,549 (GRCm39) missense probably damaging 1.00
R8902:Muc6 UTSW 7 141,233,791 (GRCm39) missense possibly damaging 0.93
R9009:Muc6 UTSW 7 141,217,018 (GRCm39) missense possibly damaging 0.73
R9010:Muc6 UTSW 7 141,226,351 (GRCm39) missense unknown
R9023:Muc6 UTSW 7 141,237,432 (GRCm39) nonsense probably null
R9058:Muc6 UTSW 7 141,218,154 (GRCm39) missense possibly damaging 0.61
R9257:Muc6 UTSW 7 141,226,738 (GRCm39) missense unknown
R9495:Muc6 UTSW 7 141,237,398 (GRCm39) missense probably damaging 0.98
R9563:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9645:Muc6 UTSW 7 141,217,783 (GRCm39) missense possibly damaging 0.53
R9659:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
R9733:Muc6 UTSW 7 141,216,310 (GRCm39) missense unknown
R9787:Muc6 UTSW 7 141,227,748 (GRCm39) nonsense probably null
R9788:Muc6 UTSW 7 141,232,100 (GRCm39) missense probably damaging 1.00
V7581:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
V7583:Muc6 UTSW 7 141,233,880 (GRCm39) missense probably benign 0.11
X0026:Muc6 UTSW 7 141,237,964 (GRCm39) missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141,218,313 (GRCm39) missense possibly damaging 0.95
Z1177:Muc6 UTSW 7 141,237,656 (GRCm39) missense probably benign 0.20
Z1177:Muc6 UTSW 7 141,236,701 (GRCm39) missense probably benign 0.29
Z1177:Muc6 UTSW 7 141,217,827 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACGTGATGACCAACTCTAGCTCCAG -3'
(R):5'- AGACTCCGACACTGAGGATAACCTG -3'

Sequencing Primer
(F):5'- CAGGCTAACAACCCTATGGGTAA -3'
(R):5'- GGAGAGATATGGAGGGGAATATCTCC -3'
Posted On 2014-02-18