Incidental Mutation 'R1295:Atm'
ID158070
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R1295 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53456530 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 2431 (V2431E)
Ref Sequence ENSEMBL: ENSMUSP00000113388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect probably damaging
Transcript: ENSMUST00000118282
AA Change: V2431E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: V2431E

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132249
SMART Domains Protein: ENSMUSP00000118199
Gene: ENSMUSG00000034218

DomainStartEndE-ValueType
PI3Kc 68 201 5.38e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000232179
AA Change: V2434E

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 unclassified probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
civil UTSW 9 53492268 missense possibly damaging 0.78
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
Strato UTSW 9 53503018 missense probably damaging 1.00
tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 intron probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAATTAATAGGTCTTCCACACACCC -3'
(R):5'- GCTGTTACCTGATAAGGTTCCATGCC -3'

Sequencing Primer
(F):5'- CAGGGTGGACTCTAAGTTAATCCTC -3'
(R):5'- ACATAGATTTGAGTGGGCTACC -3'
Posted On2014-02-18