Incidental Mutation 'R1295:Mbtd1'
ID158079
Institutional Source Beutler Lab
Gene Symbol Mbtd1
Ensembl Gene ENSMUSG00000059474
Gene Namembt domain containing 1
Synonymshemp
MMRRC Submission 039361-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1295 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93885852-93946985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93910359 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 122 (Y122C)
Ref Sequence ENSEMBL: ENSMUSP00000103482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000107850] [ENSMUST00000107852] [ENSMUST00000107853] [ENSMUST00000107854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063645
AA Change: Y122C

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474
AA Change: Y122C

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 7e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 459 1.61e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063718
AA Change: Y144C

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474
AA Change: Y144C

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
PDB:2W0T|A 74 96 7e-6 PDB
low complexity region 97 112 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
MBT 166 270 3.11e-22 SMART
MBT 278 379 1.28e-41 SMART
MBT 383 481 1.61e-38 SMART
MBT 489 585 4.11e-54 SMART
low complexity region 586 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107850
AA Change: Y122C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103482
Gene: ENSMUSG00000059474
AA Change: Y122C

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
Blast:MBT 25 52 2e-9 BLAST
PDB:2W0T|A 52 74 2e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
PDB:4C5I|B 131 201 5e-37 PDB
Blast:MBT 144 201 1e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107852
AA Change: Y122C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103484
Gene: ENSMUSG00000059474
AA Change: Y122C

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 5e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 433 1.29e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107853
AA Change: Y122C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474
AA Change: Y122C

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.8e-44 SMART
MBT 361 459 6.1e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107854
AA Change: Y122C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474
AA Change: Y122C

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.9e-44 SMART
MBT 361 459 6.2e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150237
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.1%
  • 20x: 82.0%
Validation Efficiency 98% (81/83)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe abnormalities in hematopoietic stem cell function and skeletal formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 A G 9: 121,908,717 S53G possibly damaging Het
Adgrb1 T A 15: 74,550,039 L886Q probably damaging Het
Adprhl1 G A 8: 13,248,624 T102M probably damaging Het
Akap6 A C 12: 52,887,029 K435Q probably damaging Het
Aldh7a1 T C 18: 56,546,950 probably null Het
Amfr T C 8: 93,974,804 R507G probably benign Het
Ap1m1 T A 8: 72,251,875 probably null Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Ccar1 C A 10: 62,783,882 probably null Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col5a3 A G 9: 20,808,418 F215S unknown Het
Decr1 T C 4: 15,919,207 N312S possibly damaging Het
Diaph3 A T 14: 87,007,399 W178R probably damaging Het
Dync2h1 A G 9: 7,075,752 probably benign Het
Ehd3 C A 17: 73,828,186 D352E probably damaging Het
Enpp6 T G 8: 47,065,500 I221S probably benign Het
Fam186a T C 15: 99,939,789 probably benign Het
Gm5435 G T 12: 82,495,784 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr22 A C 12: 31,709,514 I203S probably benign Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Gstcd T C 3: 133,005,628 N431D probably damaging Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Hist1h1b T C 13: 21,779,999 S186G probably benign Het
Ift140 G T 17: 25,088,933 probably null Het
Ikbke A G 1: 131,270,226 V381A probably benign Het
Ing1 A C 8: 11,561,501 I38L probably benign Het
Ing1 T A 8: 11,561,502 I38N probably damaging Het
Itga4 A G 2: 79,322,689 M907V possibly damaging Het
Kcnk12 C T 17: 87,746,373 G287D probably damaging Het
Kmt2e A C 5: 23,502,404 H1655P probably damaging Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nav3 T A 10: 109,692,102 D2240V probably damaging Het
Ndufaf3 T C 9: 108,566,693 T9A probably damaging Het
Numb C A 12: 83,796,161 probably benign Het
Prodh2 T C 7: 30,494,089 V79A probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rnf19a G T 15: 36,244,101 Y604* probably null Het
Ros1 T A 10: 52,087,932 E1744V possibly damaging Het
Rpusd2 T C 2: 119,036,927 F219L probably benign Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Serpina3b T C 12: 104,130,879 F140L probably damaging Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Thumpd2 A G 17: 81,055,888 V50A probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Ttn C A 2: 76,743,245 R17441L probably damaging Het
Usp34 A G 11: 23,384,477 Y1157C probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r6 A G 3: 64,538,273 F677S probably damaging Het
Vmn2r84 C T 10: 130,389,139 A501T probably benign Het
Wapl C T 14: 34,724,769 P605S probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zfyve26 A G 12: 79,274,920 L975P probably damaging Het
Zp3r C T 1: 130,591,444 G255D probably damaging Het
Other mutations in Mbtd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Mbtd1 APN 11 93943840 missense possibly damaging 0.94
IGL00819:Mbtd1 APN 11 93931811 critical splice acceptor site probably null
IGL01140:Mbtd1 APN 11 93924432 missense probably damaging 1.00
IGL01553:Mbtd1 APN 11 93923214 missense probably benign 0.35
IGL01893:Mbtd1 APN 11 93921412 missense probably null
IGL02218:Mbtd1 APN 11 93931803 splice site probably benign
IGL02406:Mbtd1 APN 11 93908858 missense probably damaging 1.00
IGL03002:Mbtd1 APN 11 93924490 missense probably benign 0.15
IGL03347:Mbtd1 APN 11 93923179 missense probably benign 0.01
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0311:Mbtd1 UTSW 11 93921357 splice site probably null
R0513:Mbtd1 UTSW 11 93932212 splice site probably null
R0646:Mbtd1 UTSW 11 93905212 missense probably damaging 1.00
R0734:Mbtd1 UTSW 11 93923146 missense probably damaging 1.00
R0835:Mbtd1 UTSW 11 93931839 missense probably benign 0.23
R1296:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1996:Mbtd1 UTSW 11 93932396 frame shift probably null
R2157:Mbtd1 UTSW 11 93910388 missense probably benign 0.20
R3977:Mbtd1 UTSW 11 93905175 missense probably benign
R4435:Mbtd1 UTSW 11 93932222 missense probably benign
R4589:Mbtd1 UTSW 11 93921419 missense probably damaging 1.00
R4647:Mbtd1 UTSW 11 93924611 missense probably damaging 1.00
R4824:Mbtd1 UTSW 11 93925702 missense probably benign 0.00
R4919:Mbtd1 UTSW 11 93923148 unclassified probably null
R5045:Mbtd1 UTSW 11 93931815 missense probably benign 0.26
R5095:Mbtd1 UTSW 11 93929671 missense probably damaging 1.00
R5227:Mbtd1 UTSW 11 93924648 missense possibly damaging 0.54
R5619:Mbtd1 UTSW 11 93929879 intron probably null
R6057:Mbtd1 UTSW 11 93929659 missense probably damaging 0.99
R6293:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6294:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6295:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6297:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6998:Mbtd1 UTSW 11 93924612 missense probably damaging 1.00
X0024:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGCATTGCTTTGCAACTGCATGAC -3'
(R):5'- GCACACAGTCTAAATGTGCCAACAG -3'

Sequencing Primer
(F):5'- GCATGACTGAATAACCCTGGTTC -3'
(R):5'- GTCTAAATGTGCCAACAGAAAAC -3'
Posted On2014-02-18