Incidental Mutation 'R1296:Cntn4'
ID158123
Institutional Source Beutler Lab
Gene Symbol Cntn4
Ensembl Gene ENSMUSG00000064293
Gene Namecontactin 4
SynonymsBIG-2A, Axcam
MMRRC Submission 039362-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R1296 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location105677660-106699310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106509402 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 264 (G264C)
Ref Sequence ENSEMBL: ENSMUSP00000078385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000113258] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264]
Predicted Effect probably damaging
Transcript: ENSMUST00000079416
AA Change: G264C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293
AA Change: G264C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089208
AA Change: G264C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293
AA Change: G264C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113258
AA Change: G264C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108883
Gene: ENSMUSG00000064293
AA Change: G264C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113260
AA Change: G264C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293
AA Change: G264C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113261
AA Change: G264C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293
AA Change: G264C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113264
AA Change: G264C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293
AA Change: G264C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 41 107 2.32e-8 SMART
IG 129 215 3.4e-6 SMART
IGc2 238 302 8.76e-18 SMART
IGc2 328 391 2.91e-14 SMART
IGc2 420 484 1.58e-10 SMART
IG 504 594 9.55e-10 SMART
FN3 597 683 1.54e-11 SMART
FN3 700 786 8.39e0 SMART
FN3 801 886 1.33e-6 SMART
FN3 901 981 9.85e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132395
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.1%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,719 Q567* probably null Het
Apol11a T C 15: 77,511,019 probably benign Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Cbwd1 A T 19: 24,942,675 probably benign Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Col6a4 A G 9: 106,062,853 S1293P possibly damaging Het
Col6a6 T C 9: 105,781,091 K641E probably damaging Het
Dmd A T X: 83,878,520 K1465N probably damaging Het
Dus2 T C 8: 106,053,043 V403A possibly damaging Het
Frs2 C T 10: 117,081,074 C5Y probably benign Het
Gm5174 A G 10: 86,657,002 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Ints6 T C 14: 62,704,903 probably benign Het
Ints8 T C 4: 11,221,204 I724V possibly damaging Het
Lrrk2 G A 15: 91,728,920 C749Y probably damaging Het
Map4k1 A G 7: 28,998,452 D471G possibly damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mrm2 T C 5: 140,328,553 T176A probably benign Het
Mslnl T C 17: 25,743,240 L204P probably damaging Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nfyb A G 10: 82,750,831 probably benign Het
Nlgn3 T C X: 101,308,916 probably benign Het
Nr3c1 G A 18: 39,486,998 Q79* probably null Het
Nxpe4 C G 9: 48,396,493 T299R probably benign Het
Otud4 C A 8: 79,673,974 H1105N unknown Het
Pcnx2 A G 8: 125,773,833 L1506P probably damaging Het
Prl2c5 T A 13: 13,189,424 H88Q probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rbl1 A T 2: 157,169,971 V688D probably benign Het
Rhox2g C A X: 37,643,212 probably benign Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Ryr2 T C 13: 11,687,879 probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Siglecf A T 7: 43,355,920 R435* probably null Het
Slc23a1 C T 18: 35,622,623 V407M possibly damaging Het
Slc6a14 G A X: 21,721,568 V122I probably benign Het
Spdl1 T A 11: 34,813,607 E466D unknown Het
Stau2 A G 1: 16,440,372 F121L probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tap2 G T 17: 34,211,915 V330L probably benign Het
Tbc1d1 T C 5: 64,264,432 L389P probably damaging Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Tmprss9 G T 10: 80,890,445 A510S probably benign Het
Tnxb G A 17: 34,671,577 C298Y probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ugt2a3 A T 5: 87,327,146 L413Q probably damaging Het
Vcan A G 13: 89,657,556 I2335T probably damaging Het
Vmn2r28 T C 7: 5,481,545 N552S possibly damaging Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zpld1 T C 16: 55,248,334 D138G probably damaging Het
Other mutations in Cntn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cntn4 APN 6 106506225 missense probably damaging 1.00
IGL00725:Cntn4 APN 6 106662655 missense probably damaging 1.00
IGL01062:Cntn4 APN 6 106618278 splice site probably benign
IGL01432:Cntn4 APN 6 106678334 splice site probably benign
IGL01585:Cntn4 APN 6 106618328 nonsense probably null
IGL01710:Cntn4 APN 6 106550431 missense possibly damaging 0.87
IGL01870:Cntn4 APN 6 106489715 missense possibly damaging 0.95
IGL01933:Cntn4 APN 6 106694384 missense probably damaging 0.99
IGL01937:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL01945:Cntn4 APN 6 106437904 missense probably damaging 1.00
IGL02007:Cntn4 APN 6 106655529 missense probably benign 0.03
IGL02506:Cntn4 APN 6 106618388 missense probably benign 0.24
IGL02561:Cntn4 APN 6 106523509 missense probably damaging 1.00
IGL03080:Cntn4 APN 6 106655539 missense probably damaging 1.00
IGL03338:Cntn4 APN 6 106655589 missense probably damaging 0.98
IGL03097:Cntn4 UTSW 6 106353712 missense probably benign 0.10
LCD18:Cntn4 UTSW 6 106553940 intron probably benign
R0083:Cntn4 UTSW 6 106525369 missense possibly damaging 0.79
R0098:Cntn4 UTSW 6 106618424 splice site probably benign
R0501:Cntn4 UTSW 6 106618335 missense probably damaging 1.00
R0626:Cntn4 UTSW 6 106662578 missense probably benign 0.07
R0633:Cntn4 UTSW 6 106679248 splice site probably null
R0730:Cntn4 UTSW 6 106550486 missense probably damaging 1.00
R0849:Cntn4 UTSW 6 106667457 missense probably damaging 1.00
R0883:Cntn4 UTSW 6 106667540 splice site probably benign
R0926:Cntn4 UTSW 6 106655581 missense probably benign 0.21
R1199:Cntn4 UTSW 6 106353597 splice site probably benign
R1293:Cntn4 UTSW 6 106353724 missense probably benign 0.00
R1344:Cntn4 UTSW 6 106344870 splice site probably null
R1418:Cntn4 UTSW 6 106344870 splice site probably null
R1660:Cntn4 UTSW 6 106679297 missense probably benign 0.35
R1751:Cntn4 UTSW 6 106618410 critical splice donor site probably null
R1883:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1884:Cntn4 UTSW 6 106679392 missense probably benign 0.01
R1899:Cntn4 UTSW 6 106675813 missense probably benign 0.21
R1906:Cntn4 UTSW 6 106353646 missense probably benign 0.00
R2048:Cntn4 UTSW 6 106437864 splice site probably benign
R2113:Cntn4 UTSW 6 106489697 missense probably damaging 1.00
R3177:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3277:Cntn4 UTSW 6 106437964 critical splice donor site probably null
R3944:Cntn4 UTSW 6 106618414 missense probably benign 0.10
R4401:Cntn4 UTSW 6 106489664 missense possibly damaging 0.94
R4540:Cntn4 UTSW 6 106675748 missense probably damaging 1.00
R4688:Cntn4 UTSW 6 106437949 missense probably damaging 1.00
R4697:Cntn4 UTSW 6 106525485 missense probably damaging 1.00
R4810:Cntn4 UTSW 6 106655611 missense probably benign 0.04
R4816:Cntn4 UTSW 6 106550497 missense probably benign
R4873:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4875:Cntn4 UTSW 6 106437913 missense possibly damaging 0.61
R4953:Cntn4 UTSW 6 106525418 missense probably benign 0.01
R5288:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5336:Cntn4 UTSW 6 106662634 missense possibly damaging 0.72
R5386:Cntn4 UTSW 6 106181804 missense possibly damaging 0.60
R5477:Cntn4 UTSW 6 106673950 missense possibly damaging 0.88
R5514:Cntn4 UTSW 6 106672883 missense probably damaging 1.00
R5668:Cntn4 UTSW 6 106679436 splice site silent
R6334:Cntn4 UTSW 6 106344786 missense probably benign
R6334:Cntn4 UTSW 6 106506192 missense probably benign 0.29
R6904:Cntn4 UTSW 6 106697583 missense probably benign 0.03
R6985:Cntn4 UTSW 6 106679417 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAAGGGTAATAGTGTGTAGGAGGTTGAA -3'
(R):5'- CCAGGTCGTCCTAAAGCAAGAACCA -3'

Sequencing Primer
(F):5'- AAAAAACATGTGAACAATGCTAGAG -3'
(R):5'- cacacacacacacaccaaac -3'
Posted On2014-02-18