Incidental Mutation 'R1296:Mslnl'
ID158155
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
MMRRC Submission 039362-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R1296 (G1)
Quality Score122
Status Validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25743240 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 204 (L204P)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: L204P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.1%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 G A 8: 55,871,719 Q567* probably null Het
Apol11a T C 15: 77,511,019 probably benign Het
Arhgap29 A G 3: 121,992,395 H275R probably benign Het
Arhgef17 C A 7: 100,881,269 E428* probably null Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atn1 G T 6: 124,747,787 P161Q unknown Het
Atp13a2 T C 4: 140,993,802 S99P probably damaging Het
Atp8a1 A T 5: 67,622,706 probably benign Het
Cbwd1 A T 19: 24,942,675 probably benign Het
Cdk18 T C 1: 132,119,960 probably benign Het
Cep85 A G 4: 134,167,400 W32R probably damaging Het
Cntn4 G T 6: 106,509,402 G264C probably damaging Het
Col6a4 A G 9: 106,062,853 S1293P possibly damaging Het
Col6a6 T C 9: 105,781,091 K641E probably damaging Het
Dmd A T X: 83,878,520 K1465N probably damaging Het
Dus2 T C 8: 106,053,043 V403A possibly damaging Het
Frs2 C T 10: 117,081,074 C5Y probably benign Het
Gm5174 A G 10: 86,657,002 noncoding transcript Het
Gm6990 T A 19: 56,755,334 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Grik3 G A 4: 125,704,564 probably benign Het
Haao T A 17: 83,838,838 Q69L probably benign Het
Ints6 T C 14: 62,704,903 probably benign Het
Ints8 T C 4: 11,221,204 I724V possibly damaging Het
Lrrk2 G A 15: 91,728,920 C749Y probably damaging Het
Map4k1 A G 7: 28,998,452 D471G possibly damaging Het
Mbtd1 A G 11: 93,910,359 Y122C probably damaging Het
Mrfap1 A G 5: 36,796,473 S41P possibly damaging Het
Mrm2 T C 5: 140,328,553 T176A probably benign Het
Muc6 T C 7: 141,651,879 E112G probably benign Het
Nfyb A G 10: 82,750,831 probably benign Het
Nlgn3 T C X: 101,308,916 probably benign Het
Nr3c1 G A 18: 39,486,998 Q79* probably null Het
Nxpe4 C G 9: 48,396,493 T299R probably benign Het
Otud4 C A 8: 79,673,974 H1105N unknown Het
Pcnx2 A G 8: 125,773,833 L1506P probably damaging Het
Prl2c5 T A 13: 13,189,424 H88Q probably damaging Het
Psmb2 A G 4: 126,687,032 Y73C probably damaging Het
Rbl1 A T 2: 157,169,971 V688D probably benign Het
Rhox2g C A X: 37,643,212 probably benign Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Ryr2 T C 13: 11,687,879 probably benign Het
Sele T A 1: 164,050,810 S239R probably damaging Het
Siglecf A T 7: 43,355,920 R435* probably null Het
Slc23a1 C T 18: 35,622,623 V407M possibly damaging Het
Slc6a14 G A X: 21,721,568 V122I probably benign Het
Spdl1 T A 11: 34,813,607 E466D unknown Het
Stau2 A G 1: 16,440,372 F121L probably benign Het
Stxbp1 A T 2: 32,794,636 S594T probably benign Het
Sufu G A 19: 46,454,720 probably benign Het
Tap2 G T 17: 34,211,915 V330L probably benign Het
Tbc1d1 T C 5: 64,264,432 L389P probably damaging Het
Tbx2 A G 11: 85,834,766 E181G probably damaging Het
Tmem56 A G 3: 121,207,291 V231A probably benign Het
Tmprss9 G T 10: 80,890,445 A510S probably benign Het
Tnxb G A 17: 34,671,577 C298Y probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Ugt2a3 A T 5: 87,327,146 L413Q probably damaging Het
Vcan A G 13: 89,657,556 I2335T probably damaging Het
Vmn2r28 T C 7: 5,481,545 N552S possibly damaging Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zfp598 A G 17: 24,679,649 N474S probably benign Het
Zpld1 T C 16: 55,248,334 D138G probably damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AACTTGCCCAACCAGAGAGTTGCC -3'
(R):5'- CTGTCCTGGGTTCAAACCTCAAGC -3'

Sequencing Primer
(F):5'- ACAGCCTTGGCCTGTCTG -3'
(R):5'- AAGCCCCTTGCATCTTATCTG -3'
Posted On2014-02-18