Incidental Mutation 'R1298:Gsdmc3'
ID158231
Institutional Source Beutler Lab
Gene Symbol Gsdmc3
Ensembl Gene ENSMUSG00000055827
Gene Namegasdermin C3
Synonyms9930109F21Rik
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location63857724-63878558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63860281 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 299 (L299M)
Ref Sequence ENSEMBL: ENSMUSP00000139472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089894] [ENSMUST00000185526] [ENSMUST00000190682]
Predicted Effect probably damaging
Transcript: ENSMUST00000089894
AA Change: L299M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087339
Gene: ENSMUSG00000055827
AA Change: L299M

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 2.1e-154 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185526
AA Change: L299M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140272
Gene: ENSMUSG00000055827
AA Change: L299M

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190682
AA Change: L299M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139472
Gene: ENSMUSG00000055827
AA Change: L299M

DomainStartEndE-ValueType
Pfam:Gasdermin 4 443 1.4e-145 PFAM
Meta Mutation Damage Score 0.0224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Gsdmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gsdmc3 APN 15 63859677 missense probably benign 0.05
IGL01125:Gsdmc3 APN 15 63861457 missense probably benign 0.09
R0490:Gsdmc3 UTSW 15 63860250 missense possibly damaging 0.88
R0620:Gsdmc3 UTSW 15 63859693 missense probably damaging 1.00
R0932:Gsdmc3 UTSW 15 63858551 critical splice acceptor site probably null
R1378:Gsdmc3 UTSW 15 63859586 splice site probably benign
R1815:Gsdmc3 UTSW 15 63869116 missense probably damaging 1.00
R1962:Gsdmc3 UTSW 15 63858466 missense probably damaging 1.00
R1965:Gsdmc3 UTSW 15 63858447 missense probably damaging 1.00
R2088:Gsdmc3 UTSW 15 63860214 critical splice donor site probably null
R2090:Gsdmc3 UTSW 15 63866782 missense probably benign 0.07
R2126:Gsdmc3 UTSW 15 63858534 nonsense probably null
R2276:Gsdmc3 UTSW 15 63860256 missense probably benign 0.09
R4412:Gsdmc3 UTSW 15 63866796 missense probably benign 0.18
R4913:Gsdmc3 UTSW 15 63858273 makesense probably null
R5241:Gsdmc3 UTSW 15 63864146 missense possibly damaging 0.96
R6016:Gsdmc3 UTSW 15 63868412 missense probably benign 0.07
R6026:Gsdmc3 UTSW 15 63866751 missense probably damaging 1.00
R6291:Gsdmc3 UTSW 15 63860241 missense probably benign 0.00
R6698:Gsdmc3 UTSW 15 63860271 missense possibly damaging 0.94
R7316:Gsdmc3 UTSW 15 63858402 missense possibly damaging 0.81
R7566:Gsdmc3 UTSW 15 63861661 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGCATGGAGCTGAAATCCCCAC -3'
(R):5'- CCGTTACCAGAGCCCAACAGTATG -3'

Sequencing Primer
(F):5'- GAGCTGAAATCCCCACCTTTG -3'
(R):5'- CAGAGCCCAACAGTATGTTTCATTC -3'
Posted On2014-02-18