Incidental Mutation 'R1299:Acnat1'
ID158240
Institutional Source Beutler Lab
Gene Symbol Acnat1
Ensembl Gene ENSMUSG00000070985
Gene Nameacyl-coenzyme A amino acid N-acyltransferase 1
Synonyms
MMRRC Submission 039365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1299 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49447105-49473912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49450925 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 62 (E62V)
Ref Sequence ENSEMBL: ENSMUSP00000103325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095086] [ENSMUST00000107697] [ENSMUST00000135976]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095086
AA Change: E62V

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092702
Gene: ENSMUSG00000070985
AA Change: E62V

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 144 2.2e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:Abhydrolase_5 170 360 3.6e-8 PFAM
Pfam:FSH1 191 361 4.5e-7 PFAM
Pfam:BAAT_C 206 411 5.5e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107697
AA Change: E62V

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103325
Gene: ENSMUSG00000070985
AA Change: E62V

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 5.7e-42 PFAM
Pfam:Abhydrolase_5 156 342 3.3e-8 PFAM
Pfam:BAAT_C 188 393 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135976
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,821 L2228P possibly damaging Het
Adam7 A G 14: 68,526,299 probably benign Het
Ate1 A T 7: 130,504,755 V292D probably damaging Het
Cbx8 T C 11: 119,040,850 M1V probably null Het
Cdc73 T C 1: 143,699,281 D58G probably benign Het
Cgnl1 G A 9: 71,721,712 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
D430042O09Rik A C 7: 125,852,023 M1109L probably benign Het
Fam133b T C 5: 3,554,626 probably benign Het
Fndc3a A G 14: 72,566,198 probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gpr142 A T 11: 114,804,359 Y50F probably benign Het
Gramd1c A G 16: 43,983,502 probably benign Het
Gypa G A 8: 80,496,753 V53I unknown Het
H2-DMb2 T C 17: 34,150,587 V235A probably benign Het
Igkv10-94 T C 6: 68,704,498 probably benign Het
Klhl17 T C 4: 156,230,962 Y484C probably damaging Het
Ltbp3 T C 19: 5,745,428 probably benign Het
Mapkbp1 G A 2: 120,015,404 C412Y probably damaging Het
Mblac2 C A 13: 81,711,726 C65* probably null Het
Olfr1457 T A 19: 13,095,130 N173Y possibly damaging Het
Olfr815 A G 10: 129,902,077 I211T probably benign Het
Parn G A 16: 13,664,729 T85M probably benign Het
Pcdhb22 T C 18: 37,520,590 S704P probably damaging Het
Prex1 A G 2: 166,585,907 F942L possibly damaging Het
Prox1 G T 1: 190,146,943 probably benign Het
Prss55 A T 14: 64,081,698 I70N probably damaging Het
Slc25a13 C T 6: 6,113,937 probably null Het
Smarca2 T C 19: 26,771,611 probably null Het
Smarcc2 C A 10: 128,461,378 N46K probably damaging Het
Tdpoz4 A T 3: 93,796,462 Y22F probably benign Het
Tgfbr1 T A 4: 47,396,587 probably null Het
Xpr1 A C 1: 155,417,203 I11S probably damaging Het
Zfp354b A C 11: 50,923,470 S209R probably benign Het
Zfp882 A G 8: 71,913,473 E88G probably damaging Het
Other mutations in Acnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Acnat1 APN 4 49447793 missense probably benign
IGL03241:Acnat1 APN 4 49447702 missense probably benign 0.01
R0478:Acnat1 UTSW 4 49450901 missense probably damaging 1.00
R0568:Acnat1 UTSW 4 49451003 missense possibly damaging 0.93
R1538:Acnat1 UTSW 4 49447835 missense possibly damaging 0.69
R1750:Acnat1 UTSW 4 49451042 missense probably benign 0.08
R1847:Acnat1 UTSW 4 49447716 missense possibly damaging 0.71
R1913:Acnat1 UTSW 4 49447498 missense probably damaging 1.00
R2401:Acnat1 UTSW 4 49451077 missense possibly damaging 0.72
R3195:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3196:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3948:Acnat1 UTSW 4 49447477 missense possibly damaging 0.52
R4395:Acnat1 UTSW 4 49447679 missense probably benign 0.00
R4598:Acnat1 UTSW 4 49450781 missense probably benign 0.22
R4774:Acnat1 UTSW 4 49450784 missense probably benign 0.08
R6575:Acnat1 UTSW 4 49450785 missense possibly damaging 0.53
Z1088:Acnat1 UTSW 4 49447588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAACCCGACCTTCTTGAATCTG -3'
(R):5'- GCGCCCCTTAACACCTTGATGATG -3'

Sequencing Primer
(F):5'- GCCTTGGATGGAATCCTGAC -3'
(R):5'- GATGATCAAGTTGATAGCCACAC -3'
Posted On2014-02-18