Incidental Mutation 'R1299:Fndc3a'
ID158261
Institutional Source Beutler Lab
Gene Symbol Fndc3a
Ensembl Gene ENSMUSG00000033487
Gene Namefibronectin type III domain containing 3A
Synonyms1700094E19Rik, Fndc3, D14Ertd453e, F730017H24Rik, sys
MMRRC Submission 039365-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R1299 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location72537946-72710003 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 72566198 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000089017] [ENSMUST00000162478]
Predicted Effect probably benign
Transcript: ENSMUST00000089017
SMART Domains Protein: ENSMUSP00000086411
Gene: ENSMUSG00000033487

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
FN3 266 358 3.05e-6 SMART
FN3 371 452 3.42e-9 SMART
FN3 467 549 1.84e-9 SMART
FN3 564 647 1.06e-5 SMART
FN3 662 744 2.19e-7 SMART
FN3 759 838 5.48e-8 SMART
FN3 864 937 2.28e-5 SMART
FN3 951 1032 3.22e-5 SMART
FN3 1047 1127 5.63e0 SMART
transmembrane domain 1175 1197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159144
Predicted Effect probably benign
Transcript: ENSMUST00000162478
SMART Domains Protein: ENSMUSP00000124637
Gene: ENSMUSG00000033487

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 202 216 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
FN3 266 358 3.05e-6 SMART
FN3 371 452 3.42e-9 SMART
Pfam:fn3 468 540 1.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162825
SMART Domains Protein: ENSMUSP00000124218
Gene: ENSMUSG00000033487

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 158 172 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
FN3 222 314 3.05e-6 SMART
FN3 327 408 3.42e-9 SMART
FN3 423 505 1.84e-9 SMART
FN3 520 603 1.06e-5 SMART
FN3 618 700 2.19e-7 SMART
FN3 715 794 5.48e-8 SMART
FN3 820 893 2.28e-5 SMART
FN3 907 988 3.22e-5 SMART
FN3 1003 1083 5.63e0 SMART
transmembrane domain 1131 1153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Males homozygous for an insertional mutation are sterile; females are fertile. In mutant males, spermatids form multinucleated syncytia and fail to mature, while Sertoli cells exhibit abnormal cytoplasmic vacuoles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,821 L2228P possibly damaging Het
Acnat1 T A 4: 49,450,925 E62V possibly damaging Het
Adam7 A G 14: 68,526,299 probably benign Het
Ate1 A T 7: 130,504,755 V292D probably damaging Het
Cbx8 T C 11: 119,040,850 M1V probably null Het
Cdc73 T C 1: 143,699,281 D58G probably benign Het
Cgnl1 G A 9: 71,721,712 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
D430042O09Rik A C 7: 125,852,023 M1109L probably benign Het
Fam133b T C 5: 3,554,626 probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gpr142 A T 11: 114,804,359 Y50F probably benign Het
Gramd1c A G 16: 43,983,502 probably benign Het
Gypa G A 8: 80,496,753 V53I unknown Het
H2-DMb2 T C 17: 34,150,587 V235A probably benign Het
Igkv10-94 T C 6: 68,704,498 probably benign Het
Klhl17 T C 4: 156,230,962 Y484C probably damaging Het
Ltbp3 T C 19: 5,745,428 probably benign Het
Mapkbp1 G A 2: 120,015,404 C412Y probably damaging Het
Mblac2 C A 13: 81,711,726 C65* probably null Het
Olfr1457 T A 19: 13,095,130 N173Y possibly damaging Het
Olfr815 A G 10: 129,902,077 I211T probably benign Het
Parn G A 16: 13,664,729 T85M probably benign Het
Pcdhb22 T C 18: 37,520,590 S704P probably damaging Het
Prex1 A G 2: 166,585,907 F942L possibly damaging Het
Prox1 G T 1: 190,146,943 probably benign Het
Prss55 A T 14: 64,081,698 I70N probably damaging Het
Slc25a13 C T 6: 6,113,937 probably null Het
Smarca2 T C 19: 26,771,611 probably null Het
Smarcc2 C A 10: 128,461,378 N46K probably damaging Het
Tdpoz4 A T 3: 93,796,462 Y22F probably benign Het
Tgfbr1 T A 4: 47,396,587 probably null Het
Xpr1 A C 1: 155,417,203 I11S probably damaging Het
Zfp354b A C 11: 50,923,470 S209R probably benign Het
Zfp882 A G 8: 71,913,473 E88G probably damaging Het
Other mutations in Fndc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Fndc3a APN 14 72559357 splice site probably benign
IGL01120:Fndc3a APN 14 72556662 missense probably benign 0.05
IGL01577:Fndc3a APN 14 72589858 missense probably damaging 0.99
IGL01810:Fndc3a APN 14 72566141 missense probably benign 0.01
IGL01965:Fndc3a APN 14 72540402 missense probably benign 0.09
IGL01992:Fndc3a APN 14 72574556 missense probably benign 0.25
IGL02244:Fndc3a APN 14 72556367 splice site probably benign
IGL02639:Fndc3a APN 14 72574357 missense probably benign 0.08
IGL03076:Fndc3a APN 14 72556468 missense possibly damaging 0.82
IGL03096:Fndc3a APN 14 72599119 missense probably damaging 1.00
PIT4677001:Fndc3a UTSW 14 72574595 missense probably benign 0.02
R0112:Fndc3a UTSW 14 72540495 splice site probably benign
R0379:Fndc3a UTSW 14 72556609 missense probably damaging 1.00
R0381:Fndc3a UTSW 14 72556627 missense probably benign 0.05
R0544:Fndc3a UTSW 14 72557622 splice site probably benign
R1079:Fndc3a UTSW 14 72589807 missense possibly damaging 0.81
R1424:Fndc3a UTSW 14 72574371 missense probably damaging 1.00
R1453:Fndc3a UTSW 14 72540328 nonsense probably null
R1478:Fndc3a UTSW 14 72557632 critical splice donor site probably null
R1573:Fndc3a UTSW 14 72568944 missense probably damaging 0.98
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1574:Fndc3a UTSW 14 72556557 missense probably damaging 1.00
R1743:Fndc3a UTSW 14 72652081 missense probably damaging 1.00
R1852:Fndc3a UTSW 14 72556843 missense probably damaging 0.96
R2097:Fndc3a UTSW 14 72574351 critical splice donor site probably null
R2396:Fndc3a UTSW 14 72683683 missense possibly damaging 0.92
R2512:Fndc3a UTSW 14 72556275 missense probably benign 0.00
R3722:Fndc3a UTSW 14 72540208 missense probably benign 0.39
R5470:Fndc3a UTSW 14 72574568 missense possibly damaging 0.83
R5757:Fndc3a UTSW 14 72556585 missense probably benign
R5931:Fndc3a UTSW 14 72568867 missense probably benign
R6188:Fndc3a UTSW 14 72589961 missense probably damaging 0.99
R6297:Fndc3a UTSW 14 72563540 missense probably damaging 0.98
R6638:Fndc3a UTSW 14 72559248 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGGAACCCTGGTACAGAATACAATGG -3'
(R):5'- TCAACACAAAGACCTTCTCTTGGCTC -3'

Sequencing Primer
(F):5'- ACTGGTAAATACCACCTCCTTTGAG -3'
(R):5'- CTGAGACTGAGTTATCTCAATTCATC -3'
Posted On2014-02-18