Incidental Mutation 'R1300:Ppargc1a'
ID158286
Institutional Source Beutler Lab
Gene Symbol Ppargc1a
Ensembl Gene ENSMUSG00000029167
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator 1 alpha
SynonymsA830037N07Rik, Gm11133, Pgco1, Pgc1, PPAR Gamma Coactivator-1, Pgc-1alpha, Pgc-1alphaa
MMRRC Submission 039366-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R1300 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location51454250-51567726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51548672 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 19 (E19G)
Ref Sequence ENSEMBL: ENSMUSP00000116566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031059] [ENSMUST00000127135] [ENSMUST00000132734] [ENSMUST00000151104] [ENSMUST00000196968]
Predicted Effect probably damaging
Transcript: ENSMUST00000031059
AA Change: E23G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138397
Gene: ENSMUSG00000029167
AA Change: E23G

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000127135
AA Change: E19G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115586
Gene: ENSMUSG00000029167
AA Change: E19G

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132734
AA Change: E23G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117040
Gene: ENSMUSG00000029167
AA Change: E23G

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
RRM 677 746 4.61e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151104
AA Change: E19G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116566
Gene: ENSMUSG00000029167
AA Change: E19G

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
low complexity region 137 143 N/A INTRINSIC
PDB:3D24|D 193 214 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000196968
AA Change: E23G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143553
Gene: ENSMUSG00000029167
AA Change: E23G

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
PDB:3D24|D 197 218 4e-7 PDB
low complexity region 294 300 N/A INTRINSIC
low complexity region 558 613 N/A INTRINSIC
low complexity region 615 636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcriptional coactivator that induces and coordinates gene expression regulating mitochondrial biogenesis, respiration, hepatic gluconeogenesis, thermogenic program in brown fat and muscle fiber-type switching. Mice lacking the encoded protein exhibit reduced thermogenic capacity, hyperactivity and resistance to diet-induced obesity. Mice lacking the encoded protein specifically in the heart exhibit peripartum cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, abnormal glucose and insulin homeostasis, resistance to diet induced obesity, increased oxygen consumption, spongiform encephalopathy, hyperactivity, increased startle reflex, and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cped1 T C 6: 22,119,553 V337A probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Eif2ak4 T C 2: 118,463,983 V1125A possibly damaging Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gm8674 T C 13: 49,901,722 noncoding transcript Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Neu1 A T 17: 34,934,338 Y279F possibly damaging Het
Nhsl1 A G 10: 18,408,461 H50R probably benign Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr30 T C 11: 58,455,841 Y36C probably damaging Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Parp10 C A 15: 76,241,990 D333Y possibly damaging Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Syt1 A T 10: 108,631,821 V205D possibly damaging Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Ppargc1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Ppargc1a APN 5 51498031 splice site probably null
IGL01063:Ppargc1a APN 5 51474322 missense probably benign 0.43
IGL01800:Ppargc1a APN 5 51494721 missense probably damaging 1.00
IGL02179:Ppargc1a APN 5 51473711 missense possibly damaging 0.90
IGL02336:Ppargc1a APN 5 51495726 nonsense probably null
IGL02368:Ppargc1a APN 5 51474156 missense probably benign 0.05
R2048:Ppargc1a UTSW 5 51548516 missense probably damaging 1.00
R2054:Ppargc1a UTSW 5 51473788 missense possibly damaging 0.47
R2211:Ppargc1a UTSW 5 51474259 missense possibly damaging 0.47
R2848:Ppargc1a UTSW 5 51473809 missense probably benign 0.02
R4094:Ppargc1a UTSW 5 51490064 missense possibly damaging 0.47
R4419:Ppargc1a UTSW 5 51494702 missense probably damaging 1.00
R4552:Ppargc1a UTSW 5 51463215 intron probably benign
R4702:Ppargc1a UTSW 5 51495696 missense possibly damaging 0.73
R4855:Ppargc1a UTSW 5 51474222 missense possibly damaging 0.89
R5287:Ppargc1a UTSW 5 51462825 intron probably benign
R5313:Ppargc1a UTSW 5 51458239 utr 3 prime probably benign
R5403:Ppargc1a UTSW 5 51462825 intron probably benign
R5711:Ppargc1a UTSW 5 51474220 missense probably damaging 1.00
R5918:Ppargc1a UTSW 5 51463237 intron probably benign
R5940:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6170:Ppargc1a UTSW 5 51473911 missense probably damaging 1.00
R6415:Ppargc1a UTSW 5 51462834 intron probably benign
X0019:Ppargc1a UTSW 5 51548678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAGAGCCCCTACATGCTGGAG -3'
(R):5'- TGCATCCCGAGGTGATTAAAGCCC -3'

Sequencing Primer
(F):5'- AGAAGCTCATTTCTCCAGGG -3'
(R):5'- GATTAAAGCCCCAGAGGCCAG -3'
Posted On2014-02-18