Incidental Mutation 'R1300:Cped1'
ID158289
Institutional Source Beutler Lab
Gene Symbol Cped1
Ensembl Gene ENSMUSG00000062980
Gene Namecadherin-like and PC-esterase domain containing 1
SynonymsA430107O13Rik
MMRRC Submission 039366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1300 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location21985916-22256404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22119553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 337 (V337A)
Ref Sequence ENSEMBL: ENSMUSP00000111040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115382] [ENSMUST00000115383] [ENSMUST00000153922]
Predicted Effect probably benign
Transcript: ENSMUST00000115382
AA Change: V337A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111040
Gene: ENSMUSG00000062980
AA Change: V337A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115383
AA Change: V337A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980
AA Change: V337A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 574 663 1e-9 PFAM
Pfam:PC-Esterase 753 1018 2e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137437
AA Change: V199A
SMART Domains Protein: ENSMUSP00000119808
Gene: ENSMUSG00000062980
AA Change: V199A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 570 663 6.2e-12 PFAM
Pfam:PC-Esterase 753 963 1.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153922
SMART Domains Protein: ENSMUSP00000138562
Gene: ENSMUSG00000062980

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Eif2ak4 T C 2: 118,463,983 V1125A possibly damaging Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gm8674 T C 13: 49,901,722 noncoding transcript Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Neu1 A T 17: 34,934,338 Y279F possibly damaging Het
Nhsl1 A G 10: 18,408,461 H50R probably benign Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr30 T C 11: 58,455,841 Y36C probably damaging Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Parp10 C A 15: 76,241,990 D333Y possibly damaging Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Ppargc1a T C 5: 51,548,672 E19G probably damaging Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Syt1 A T 10: 108,631,821 V205D possibly damaging Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Cped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cped1 APN 6 22215523 missense probably damaging 1.00
IGL00909:Cped1 APN 6 22122427 splice site probably benign
IGL01434:Cped1 APN 6 22017005 missense probably damaging 0.99
IGL01572:Cped1 APN 6 22051301 missense probably benign 0.00
IGL02063:Cped1 APN 6 22138702 missense probably damaging 0.98
IGL02216:Cped1 APN 6 22059945 missense probably damaging 1.00
IGL02257:Cped1 APN 6 22145607 missense possibly damaging 0.86
IGL02541:Cped1 APN 6 22120989 missense probably benign 0.00
IGL03008:Cped1 APN 6 22233602 missense probably benign 0.01
IGL03237:Cped1 APN 6 22233596 missense probably damaging 1.00
PIT4382001:Cped1 UTSW 6 22222450 nonsense probably null
PIT4812001:Cped1 UTSW 6 22122294 missense probably benign 0.02
R0048:Cped1 UTSW 6 22119602 missense probably benign 0.08
R0128:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0130:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0267:Cped1 UTSW 6 22119476 missense probably damaging 0.99
R0374:Cped1 UTSW 6 22222546 splice site probably benign
R0482:Cped1 UTSW 6 22016958 missense probably benign 0.32
R0734:Cped1 UTSW 6 22085041 missense probably damaging 1.00
R1033:Cped1 UTSW 6 22016951 missense probably damaging 0.99
R1118:Cped1 UTSW 6 22237699 missense probably benign 0.19
R1181:Cped1 UTSW 6 22215562 missense probably damaging 0.99
R1485:Cped1 UTSW 6 22132388 critical splice donor site probably null
R1507:Cped1 UTSW 6 22122261 missense probably damaging 1.00
R1830:Cped1 UTSW 6 22237728 missense probably damaging 1.00
R1879:Cped1 UTSW 6 22085015 splice site probably null
R1902:Cped1 UTSW 6 22120981 splice site probably null
R1991:Cped1 UTSW 6 22233927 missense probably damaging 1.00
R2020:Cped1 UTSW 6 22143964 missense probably benign 0.38
R2883:Cped1 UTSW 6 22143979 missense probably damaging 1.00
R3011:Cped1 UTSW 6 22088696 missense probably damaging 1.00
R4466:Cped1 UTSW 6 22123652 missense probably benign 0.29
R4668:Cped1 UTSW 6 22237653 missense probably benign 0.06
R4808:Cped1 UTSW 6 22088757 missense probably damaging 1.00
R5402:Cped1 UTSW 6 22143952 missense probably benign 0.05
R5417:Cped1 UTSW 6 22233580 missense probably null 0.01
R5741:Cped1 UTSW 6 22123621 missense probably benign 0.02
R5821:Cped1 UTSW 6 22138682 missense probably benign 0.00
R5977:Cped1 UTSW 6 22254608 missense probably damaging 1.00
R6255:Cped1 UTSW 6 22138715 splice site probably null
R6304:Cped1 UTSW 6 22016923 missense probably benign 0.14
R6416:Cped1 UTSW 6 22123649 missense probably damaging 1.00
R6444:Cped1 UTSW 6 21986931 missense probably benign 0.00
R6617:Cped1 UTSW 6 22215547 nonsense probably null
R6650:Cped1 UTSW 6 22233976 missense probably damaging 1.00
R7048:Cped1 UTSW 6 22119470 missense probably benign 0.36
R7083:Cped1 UTSW 6 22123580 missense probably benign 0.01
R7234:Cped1 UTSW 6 22254626 missense probably damaging 0.99
R7387:Cped1 UTSW 6 22059934 missense probably benign 0.01
X0022:Cped1 UTSW 6 21987046 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACTGACCTTGGAAACAATAGGCAGAT -3'
(R):5'- AATGGCATGTACCAAACTCTGAAGTCTT -3'

Sequencing Primer
(F):5'- TGAGACATTCCTGAGGACCA -3'
(R):5'- ctgtctgtctctgtctctgtc -3'
Posted On2014-02-18