Incidental Mutation 'R1300:Olfr30'
ID158316
Institutional Source Beutler Lab
Gene Symbol Olfr30
Ensembl Gene ENSMUSG00000043314
Gene Nameolfactory receptor 30
SynonymsMTPCR07, MOR281-1, GA_x6K02T2NKPP-957001-957948
MMRRC Submission 039366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1300 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58454105-58462270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58455841 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 36 (Y36C)
Ref Sequence ENSEMBL: ENSMUSP00000148907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055204] [ENSMUST00000064614] [ENSMUST00000215691]
Predicted Effect probably damaging
Transcript: ENSMUST00000055204
AA Change: Y36C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055961
Gene: ENSMUSG00000043314
AA Change: Y36C

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 36 252 1.7e-6 PFAM
Pfam:7tm_1 42 291 8.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064614
SMART Domains Protein: ENSMUSP00000063665
Gene: ENSMUSG00000052642

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UPAR_LY6 47 124 1.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215691
AA Change: Y36C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cped1 T C 6: 22,119,553 V337A probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Eif2ak4 T C 2: 118,463,983 V1125A possibly damaging Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gm8674 T C 13: 49,901,722 noncoding transcript Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Neu1 A T 17: 34,934,338 Y279F possibly damaging Het
Nhsl1 A G 10: 18,408,461 H50R probably benign Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Parp10 C A 15: 76,241,990 D333Y possibly damaging Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Ppargc1a T C 5: 51,548,672 E19G probably damaging Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Syt1 A T 10: 108,631,821 V205D possibly damaging Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Olfr30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Olfr30 APN 11 58455262 missense probably damaging 1.00
IGL02001:Olfr30 APN 11 58455509 missense probably benign 0.33
IGL02170:Olfr30 APN 11 58455080 missense probably damaging 1.00
IGL02638:Olfr30 APN 11 58455047 missense probably damaging 1.00
ANU22:Olfr30 UTSW 11 58455262 missense probably damaging 1.00
R0502:Olfr30 UTSW 11 58455314 missense possibly damaging 0.54
R0784:Olfr30 UTSW 11 58455305 missense possibly damaging 0.63
R1451:Olfr30 UTSW 11 58455532 missense probably benign 0.00
R1642:Olfr30 UTSW 11 58455838 missense probably benign
R1754:Olfr30 UTSW 11 58455262 missense probably damaging 1.00
R1854:Olfr30 UTSW 11 58455431 missense probably damaging 1.00
R2920:Olfr30 UTSW 11 58455577 missense probably damaging 1.00
R3160:Olfr30 UTSW 11 58455227 missense probably damaging 1.00
R3162:Olfr30 UTSW 11 58455227 missense probably damaging 1.00
R4791:Olfr30 UTSW 11 58455544 missense possibly damaging 0.83
R4964:Olfr30 UTSW 11 58455907 missense probably benign 0.05
R5433:Olfr30 UTSW 11 58455854 missense probably damaging 0.99
R5543:Olfr30 UTSW 11 58455167 missense probably damaging 1.00
R6649:Olfr30 UTSW 11 58455568 missense probably damaging 0.98
R6653:Olfr30 UTSW 11 58455568 missense probably damaging 0.98
R7388:Olfr30 UTSW 11 58455655 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAAAGAGATGCTCGTCCAACC -3'
(R):5'- AGCACTGCTTTCACTACAGGCTATG -3'

Sequencing Primer
(F):5'- CAAAGAGAAAGCCTACTATCATCTTG -3'
(R):5'- GGTTTTCCTGTGAAATAATGACCC -3'
Posted On2014-02-18