Incidental Mutation 'R1300:Parp10'
ID158330
Institutional Source Beutler Lab
Gene Symbol Parp10
Ensembl Gene ENSMUSG00000063268
Gene Namepoly (ADP-ribose) polymerase family, member 10
Synonyms
MMRRC Submission 039366-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1300 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76231174-76243441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76241990 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 333 (D333Y)
Ref Sequence ENSEMBL: ENSMUSP00000129765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023225] [ENSMUST00000075689] [ENSMUST00000165738] [ENSMUST00000229380] [ENSMUST00000229772] [ENSMUST00000230347]
Predicted Effect probably benign
Transcript: ENSMUST00000023225
SMART Domains Protein: ENSMUSP00000023225
Gene: ENSMUSG00000022564

DomainStartEndE-ValueType
low complexity region 27 101 N/A INTRINSIC
Pfam:Bax1-I 133 340 6.9e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000075689
AA Change: D333Y

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075110
Gene: ENSMUSG00000063268
AA Change: D333Y

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165738
AA Change: D333Y

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129765
Gene: ENSMUSG00000063268
AA Change: D333Y

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166151
Predicted Effect probably benign
Transcript: ENSMUST00000229380
Predicted Effect probably benign
Transcript: ENSMUST00000229772
Predicted Effect probably benign
Transcript: ENSMUST00000230347
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) polymerases (PARPs), such as PARP10, regulate gene transcription by altering chromatin organization by adding ADP-ribose to histones. PARPs can also function as transcriptional cofactors (Yu et al., 2005 [PubMed 15674325]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cped1 T C 6: 22,119,553 V337A probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Eif2ak4 T C 2: 118,463,983 V1125A possibly damaging Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gm8674 T C 13: 49,901,722 noncoding transcript Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Neu1 A T 17: 34,934,338 Y279F possibly damaging Het
Nhsl1 A G 10: 18,408,461 H50R probably benign Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr30 T C 11: 58,455,841 Y36C probably damaging Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Ppargc1a T C 5: 51,548,672 E19G probably damaging Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Syt1 A T 10: 108,631,821 V205D possibly damaging Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Parp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Parp10 APN 15 76241677 missense probably benign 0.09
IGL01419:Parp10 APN 15 76241388 missense probably damaging 1.00
PIT4687001:Parp10 UTSW 15 76240922 missense probably benign 0.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0126:Parp10 UTSW 15 76243066 missense probably damaging 0.98
R0207:Parp10 UTSW 15 76242633 missense probably benign 0.00
R1412:Parp10 UTSW 15 76243084 missense probably damaging 0.99
R1510:Parp10 UTSW 15 76241417 missense probably damaging 1.00
R1670:Parp10 UTSW 15 76242070 missense probably benign 0.01
R1875:Parp10 UTSW 15 76242851 missense probably damaging 1.00
R2219:Parp10 UTSW 15 76233583 missense probably damaging 1.00
R2351:Parp10 UTSW 15 76242856 missense probably benign
R4027:Parp10 UTSW 15 76241154 critical splice donor site probably null
R4659:Parp10 UTSW 15 76242985 missense probably damaging 1.00
R4763:Parp10 UTSW 15 76233427 missense probably damaging 0.99
R4828:Parp10 UTSW 15 76243081 missense probably benign 0.00
R5066:Parp10 UTSW 15 76240946 splice site probably benign
R5090:Parp10 UTSW 15 76241725 missense probably damaging 0.97
R5495:Parp10 UTSW 15 76243166 missense probably benign
R6271:Parp10 UTSW 15 76242002 missense probably benign
R6335:Parp10 UTSW 15 76242188 missense probably benign 0.00
R6503:Parp10 UTSW 15 76242484 missense probably damaging 1.00
R6606:Parp10 UTSW 15 76240108 missense possibly damaging 0.66
R6868:Parp10 UTSW 15 76243106 missense probably damaging 1.00
R7197:Parp10 UTSW 15 76242416 missense probably damaging 1.00
X0027:Parp10 UTSW 15 76241504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCAAGTGGGAAAAGGGCAAC -3'
(R):5'- TTGGTCATGCGCCTACAGGAAC -3'

Sequencing Primer
(F):5'- AGGGCAACATCTTCTAGGCTG -3'
(R):5'- CGCCTACAGGAACTGGAG -3'
Posted On2014-02-18