Incidental Mutation 'R1300:Neu1'
ID158334
Institutional Source Beutler Lab
Gene Symbol Neu1
Ensembl Gene ENSMUSG00000007038
Gene Nameneuraminidase 1
SynonymsApl, Neu-1, sialidase 1, lysosomal sialidase, G9, Map-2, Bat-7, Bat7, Aglp
MMRRC Submission 039366-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1300 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34931253-34935953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34934338 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 279 (Y279F)
Ref Sequence ENSEMBL: ENSMUSP00000007253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000007253] [ENSMUST00000169230]
Predicted Effect probably benign
Transcript: ENSMUST00000007249
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000007253
AA Change: Y279F

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000007253
Gene: ENSMUSG00000007038
AA Change: Y279F

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:BNR_3 74 249 1e-16 PFAM
Pfam:BNR_2 82 377 1.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169230
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174715
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice develop features of early-onset lysosomal storage disease (sialidosis), including severe nephropathy, edema, splenomegaly, kyphosis and oligosacchariduria, and display myoclonus, lordosis, extramedullary hematopoiesis, dyspnea, weight loss, gait defects, tremors and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cped1 T C 6: 22,119,553 V337A probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Eif2ak4 T C 2: 118,463,983 V1125A possibly damaging Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gm8674 T C 13: 49,901,722 noncoding transcript Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Nhsl1 A G 10: 18,408,461 H50R probably benign Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr30 T C 11: 58,455,841 Y36C probably damaging Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Parp10 C A 15: 76,241,990 D333Y possibly damaging Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Ppargc1a T C 5: 51,548,672 E19G probably damaging Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Syt1 A T 10: 108,631,821 V205D possibly damaging Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Neu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Neu1 APN 17 34934716 missense probably benign 0.34
IGL02197:Neu1 APN 17 34934665 missense possibly damaging 0.92
IGL02442:Neu1 APN 17 34934469 missense probably benign
IGL02545:Neu1 APN 17 34931501 missense probably benign 0.41
FR4340:Neu1 UTSW 17 34932558 unclassified probably benign
R0331:Neu1 UTSW 17 34934170 missense possibly damaging 0.62
R0508:Neu1 UTSW 17 34932784 missense probably benign 0.07
R0646:Neu1 UTSW 17 34934760 missense probably damaging 1.00
R0683:Neu1 UTSW 17 34934325 unclassified probably null
R1545:Neu1 UTSW 17 34934398 missense probably benign 0.00
R1552:Neu1 UTSW 17 34932113 unclassified probably benign
R2107:Neu1 UTSW 17 34934398 missense probably benign 0.00
R2108:Neu1 UTSW 17 34934398 missense probably benign 0.00
R2279:Neu1 UTSW 17 34934374 missense probably damaging 1.00
R2291:Neu1 UTSW 17 34932766 missense probably damaging 1.00
R2895:Neu1 UTSW 17 34932782 missense probably benign 0.08
R4747:Neu1 UTSW 17 34934383 missense possibly damaging 0.77
R6010:Neu1 UTSW 17 34932055 missense probably damaging 1.00
R6122:Neu1 UTSW 17 34934754 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACGATTTCAACCCCGACGAG -3'
(R):5'- TGCCAGGATGTACCATTGCTGAAAC -3'

Sequencing Primer
(F):5'- AGTGCCAGGTCAGGAGTC -3'
(R):5'- GATGTACCATTGCTGAAACTCCAG -3'
Posted On2014-02-18