Incidental Mutation 'R1302:Gle1'
ID158403
Institutional Source Beutler Lab
Gene Symbol Gle1
Ensembl Gene ENSMUSG00000019715
Gene NameGLE1 RNA export mediator (yeast)
Synonyms4933405K21Rik
MMRRC Submission 039368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1302 (G1)
Quality Score161
Status Not validated
Chromosome2
Chromosomal Location29935426-29960371 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to G at 29952552 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019859]
Predicted Effect probably null
Transcript: ENSMUST00000019859
SMART Domains Protein: ENSMUSP00000019859
Gene: ENSMUSG00000019715

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
coiled coil region 154 275 N/A INTRINSIC
coiled coil region 306 356 N/A INTRINSIC
Pfam:GLE1 397 650 2.4e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127390
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted 75-kDa polypeptide with high sequence and structure homology to yeast Gle1p, which is nuclear protein with a leucine-rich nuclear export sequence essential for poly(A)+RNA export. Inhibition of human GLE1L by microinjection of antibodies against GLE1L in HeLa cells resulted in inhibition of poly(A)+RNA export. Immunoflourescence studies show that GLE1L is localized at the nuclear pore complexes. This localization suggests that GLE1L may act at a terminal step in the export of mature RNA messages to the cytoplasm. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik A T 8: 124,839,868 I271N probably damaging Het
5031439G07Rik A G 15: 84,953,276 Y279H probably damaging Het
Abcg2 T A 6: 58,685,817 M548K probably damaging Het
Acat1 T C 9: 53,589,225 D257G possibly damaging Het
Adamts4 G A 1: 171,253,183 G360R probably damaging Het
Akr1c12 T C 13: 4,272,329 D238G probably damaging Het
Ankrd1 C T 19: 36,115,003 G275S probably damaging Het
Ascc3 T A 10: 50,604,794 M1K probably null Het
Atf7ip2 T C 16: 10,240,608 S304P possibly damaging Het
Casp4 T A 9: 5,328,518 C333* probably null Het
Ccdc68 G A 18: 69,938,962 V37M probably damaging Het
Cda T A 4: 138,351,191 I87F probably damaging Het
Chst1 A T 2: 92,613,519 D112V probably damaging Het
Chtf18 T C 17: 25,719,158 D967G probably damaging Het
Col5a1 A G 2: 28,005,236 R1106G probably damaging Het
Coro1b T G 19: 4,149,377 F12V probably damaging Het
Ctif G T 18: 75,521,678 P259Q probably benign Het
Duox1 A T 2: 122,347,279 I1515F probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Flt1 A G 5: 147,564,240 Y1328H possibly damaging Het
Frem2 T C 3: 53,655,538 D516G probably benign Het
Gin1 A T 1: 97,775,589 K46* probably null Het
Gm11146 T G 16: 77,602,082 I5L unknown Het
Gm597 A T 1: 28,776,340 D870E probably benign Het
Gpr153 C T 4: 152,279,943 T152M probably damaging Het
H1foo A T 6: 115,947,649 R39* probably null Het
Hdlbp A T 1: 93,423,385 probably null Het
Ifi207 A T 1: 173,735,295 L95Q possibly damaging Het
Ikzf3 G T 11: 98,516,920 P32T probably benign Het
Ints10 T A 8: 68,827,312 V697E probably damaging Het
Krt14 A G 11: 100,203,347 S474P probably damaging Het
L3mbtl3 T A 10: 26,327,769 I388F unknown Het
Ldha A C 7: 46,847,639 Q7P probably damaging Het
Lrwd1 A G 5: 136,132,413 S232P probably benign Het
Med1 G T 11: 98,157,449 D840E possibly damaging Het
Med23 T A 10: 24,888,422 probably null Het
Naip5 G A 13: 100,221,591 P1046S possibly damaging Het
Ndufa4l2 A T 10: 127,515,432 M31L probably benign Het
Nlrp4f A G 13: 65,194,557 S425P possibly damaging Het
Nova1 A T 12: 46,720,798 H113Q unknown Het
Npc1 T C 18: 12,195,085 K1056E probably benign Het
Nrbp1 A G 5: 31,249,889 H354R probably benign Het
Ogfod3 A G 11: 121,183,474 F250L probably damaging Het
Pclo A G 5: 14,681,633 D3383G unknown Het
Pde1b T A 15: 103,527,599 D457E probably benign Het
Pkd1 C G 17: 24,568,236 S581R probably benign Het
Pno1 T A 11: 17,204,545 Q212L probably benign Het
Polr3b C T 10: 84,632,486 P112L probably damaging Het
Pomk T A 8: 25,983,074 I284F probably damaging Het
Rapgef4 A T 2: 72,045,160 D119V probably benign Het
Rprm A T 2: 54,085,153 L51Q probably benign Het
Taok3 A C 5: 117,199,043 S58R possibly damaging Het
Tmprss9 T A 10: 80,895,129 S830T probably benign Het
Tnfrsf1a G A 6: 125,356,916 C44Y probably damaging Het
Ubr5 A T 15: 38,041,479 D235E possibly damaging Het
Vapb C A 2: 173,771,537 F76L possibly damaging Het
Vmn2r72 T C 7: 85,738,257 I700V probably damaging Het
Wwc1 G A 11: 35,844,157 R964W probably damaging Het
Zfp644 A T 5: 106,634,899 V1203D probably damaging Het
Other mutations in Gle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Gle1 APN 2 29939289 splice site probably benign
IGL01880:Gle1 APN 2 29943750 missense possibly damaging 0.53
IGL02293:Gle1 APN 2 29957760 missense probably benign 0.00
IGL02859:Gle1 APN 2 29949228 missense probably damaging 1.00
IGL03368:Gle1 APN 2 29943793 missense probably damaging 1.00
R0535:Gle1 UTSW 2 29957805 missense probably damaging 1.00
R0608:Gle1 UTSW 2 29940228 missense probably benign 0.01
R0839:Gle1 UTSW 2 29958450 missense probably benign 0.28
R0908:Gle1 UTSW 2 29936121 missense probably benign 0.06
R1102:Gle1 UTSW 2 29944054 missense possibly damaging 0.88
R1202:Gle1 UTSW 2 29949265 missense probably damaging 1.00
R2184:Gle1 UTSW 2 29949018 missense probably damaging 1.00
R2213:Gle1 UTSW 2 29949301 missense probably damaging 0.97
R4151:Gle1 UTSW 2 29944044 missense probably damaging 1.00
R4172:Gle1 UTSW 2 29938526 missense probably benign
R4732:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4733:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4775:Gle1 UTSW 2 29936061 missense possibly damaging 0.86
R4817:Gle1 UTSW 2 29936211 missense probably benign 0.00
R4824:Gle1 UTSW 2 29940203 missense possibly damaging 0.82
R4869:Gle1 UTSW 2 29936020 missense possibly damaging 0.69
R4909:Gle1 UTSW 2 29936080 missense probably benign 0.01
R5036:Gle1 UTSW 2 29936211 missense probably benign 0.00
R5298:Gle1 UTSW 2 29948943 missense probably benign 0.02
R5903:Gle1 UTSW 2 29940281 missense probably benign 0.00
R6345:Gle1 UTSW 2 29936115 missense probably benign 0.00
R6529:Gle1 UTSW 2 29935527 missense possibly damaging 0.56
R7144:Gle1 UTSW 2 29943793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGAATAGACAATTAGTGTGCCGTGA -3'
(R):5'- GCTGGGTAACGGGAGCCCAT -3'

Sequencing Primer
(F):5'- cagtaagttcaaagccagcc -3'
(R):5'- TAACGGGAGCCCATTCTTGG -3'
Posted On2014-02-18