Incidental Mutation 'R1302:Gpr153'
ID158412
Institutional Source Beutler Lab
Gene Symbol Gpr153
Ensembl Gene ENSMUSG00000042804
Gene NameG protein-coupled receptor 153
Synonyms1110065N12Rik, PGR1
MMRRC Submission 039368-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1302 (G1)
Quality Score103
Status Not validated
Chromosome4
Chromosomal Location152274232-152285337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152279943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 152 (T152M)
Ref Sequence ENSEMBL: ENSMUSP00000101276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055754] [ENSMUST00000105650] [ENSMUST00000105651]
Predicted Effect probably damaging
Transcript: ENSMUST00000055754
AA Change: T152M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052742
Gene: ENSMUSG00000042804
AA Change: T152M

DomainStartEndE-ValueType
Pfam:7tm_1 24 298 1.2e-14 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105650
AA Change: T152M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101275
Gene: ENSMUSG00000042804
AA Change: T152M

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.4e-18 PFAM
low complexity region 478 495 N/A INTRINSIC
low complexity region 582 594 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105651
AA Change: T152M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101276
Gene: ENSMUSG00000042804
AA Change: T152M

DomainStartEndE-ValueType
Pfam:7tm_1 24 297 5.3e-17 PFAM
low complexity region 501 518 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144035
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the Class A rhodopsin superfamily of G protein coupled receptors. The encoded protein is expressed primarily in the central nervous system. A knockdown of the orthologous gene in rat is associated with a significant reduction in food intake and impaired decision making ability. Mutations in this gene are associated with schizophrenia, autism, and other neuropsychiatric disorders. The expression of this gene is activated by the glioma-associated oncogene homolog 1 transcription factor which, in turn, is activated by sonic hedgehog in normal and tumorigenic cells. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik A T 8: 124,839,868 I271N probably damaging Het
5031439G07Rik A G 15: 84,953,276 Y279H probably damaging Het
Abcg2 T A 6: 58,685,817 M548K probably damaging Het
Acat1 T C 9: 53,589,225 D257G possibly damaging Het
Adamts4 G A 1: 171,253,183 G360R probably damaging Het
Akr1c12 T C 13: 4,272,329 D238G probably damaging Het
Ankrd1 C T 19: 36,115,003 G275S probably damaging Het
Ascc3 T A 10: 50,604,794 M1K probably null Het
Atf7ip2 T C 16: 10,240,608 S304P possibly damaging Het
Casp4 T A 9: 5,328,518 C333* probably null Het
Ccdc68 G A 18: 69,938,962 V37M probably damaging Het
Cda T A 4: 138,351,191 I87F probably damaging Het
Chst1 A T 2: 92,613,519 D112V probably damaging Het
Chtf18 T C 17: 25,719,158 D967G probably damaging Het
Col5a1 A G 2: 28,005,236 R1106G probably damaging Het
Coro1b T G 19: 4,149,377 F12V probably damaging Het
Ctif G T 18: 75,521,678 P259Q probably benign Het
Duox1 A T 2: 122,347,279 I1515F probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Flt1 A G 5: 147,564,240 Y1328H possibly damaging Het
Frem2 T C 3: 53,655,538 D516G probably benign Het
Gin1 A T 1: 97,775,589 K46* probably null Het
Gle1 C G 2: 29,952,552 probably null Het
Gm11146 T G 16: 77,602,082 I5L unknown Het
Gm597 A T 1: 28,776,340 D870E probably benign Het
H1foo A T 6: 115,947,649 R39* probably null Het
Hdlbp A T 1: 93,423,385 probably null Het
Ifi207 A T 1: 173,735,295 L95Q possibly damaging Het
Ikzf3 G T 11: 98,516,920 P32T probably benign Het
Ints10 T A 8: 68,827,312 V697E probably damaging Het
Krt14 A G 11: 100,203,347 S474P probably damaging Het
L3mbtl3 T A 10: 26,327,769 I388F unknown Het
Ldha A C 7: 46,847,639 Q7P probably damaging Het
Lrwd1 A G 5: 136,132,413 S232P probably benign Het
Med1 G T 11: 98,157,449 D840E possibly damaging Het
Med23 T A 10: 24,888,422 probably null Het
Naip5 G A 13: 100,221,591 P1046S possibly damaging Het
Ndufa4l2 A T 10: 127,515,432 M31L probably benign Het
Nlrp4f A G 13: 65,194,557 S425P possibly damaging Het
Nova1 A T 12: 46,720,798 H113Q unknown Het
Npc1 T C 18: 12,195,085 K1056E probably benign Het
Nrbp1 A G 5: 31,249,889 H354R probably benign Het
Ogfod3 A G 11: 121,183,474 F250L probably damaging Het
Pclo A G 5: 14,681,633 D3383G unknown Het
Pde1b T A 15: 103,527,599 D457E probably benign Het
Pkd1 C G 17: 24,568,236 S581R probably benign Het
Pno1 T A 11: 17,204,545 Q212L probably benign Het
Polr3b C T 10: 84,632,486 P112L probably damaging Het
Pomk T A 8: 25,983,074 I284F probably damaging Het
Rapgef4 A T 2: 72,045,160 D119V probably benign Het
Rprm A T 2: 54,085,153 L51Q probably benign Het
Taok3 A C 5: 117,199,043 S58R possibly damaging Het
Tmprss9 T A 10: 80,895,129 S830T probably benign Het
Tnfrsf1a G A 6: 125,356,916 C44Y probably damaging Het
Ubr5 A T 15: 38,041,479 D235E possibly damaging Het
Vapb C A 2: 173,771,537 F76L possibly damaging Het
Vmn2r72 T C 7: 85,738,257 I700V probably damaging Het
Wwc1 G A 11: 35,844,157 R964W probably damaging Het
Zfp644 A T 5: 106,634,899 V1203D probably damaging Het
Other mutations in Gpr153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Gpr153 APN 4 152281966 unclassified probably benign
IGL01368:Gpr153 APN 4 152282994 missense probably benign 0.40
IGL01568:Gpr153 APN 4 152282368 splice site probably null
IGL01672:Gpr153 APN 4 152279913 nonsense probably null
R0735:Gpr153 UTSW 4 152279373 nonsense probably null
R0925:Gpr153 UTSW 4 152281874 missense probably benign
R1829:Gpr153 UTSW 4 152282392 missense possibly damaging 0.70
R2041:Gpr153 UTSW 4 152283353 missense probably benign
R4698:Gpr153 UTSW 4 152281783 missense probably damaging 1.00
R5069:Gpr153 UTSW 4 152279883 missense probably damaging 0.99
R5623:Gpr153 UTSW 4 152281941 missense possibly damaging 0.89
R5800:Gpr153 UTSW 4 152280077 nonsense probably null
R5940:Gpr153 UTSW 4 152283375 missense probably benign 0.12
R6773:Gpr153 UTSW 4 152279300 missense probably damaging 1.00
R6944:Gpr153 UTSW 4 152279363 missense probably damaging 1.00
R7486:Gpr153 UTSW 4 152282401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGGTACAAGGCTCTGCCATGATG -3'
(R):5'- CCCGTGATCTGTAGCGAAGTTCTG -3'

Sequencing Primer
(F):5'- CTCTGCCATGATGGCTGG -3'
(R):5'- AGGCTCTGAGCCATCAATG -3'
Posted On2014-02-18