Incidental Mutation 'R1302:Lrwd1'
ID158417
Institutional Source Beutler Lab
Gene Symbol Lrwd1
Ensembl Gene ENSMUSG00000029703
Gene Nameleucine-rich repeats and WD repeat domain containing 1
Synonyms1200011O22Rik, Orca
MMRRC Submission 039368-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R1302 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136122772-136136074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136132413 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 232 (S232P)
Ref Sequence ENSEMBL: ENSMUSP00000006301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006301] [ENSMUST00000041100] [ENSMUST00000125923] [ENSMUST00000136634] [ENSMUST00000143229] [ENSMUST00000150406]
Predicted Effect probably benign
Transcript: ENSMUST00000006301
AA Change: S232P

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000006301
Gene: ENSMUSG00000029703
AA Change: S232P

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
LRR_TYP 46 69 3.16e-3 SMART
LRR 90 113 1.58e2 SMART
WD40 271 327 6.36e1 SMART
Blast:WD40 330 380 2e-12 BLAST
WD40 383 423 1.49e-7 SMART
WD40 434 473 2.28e2 SMART
Blast:WD40 484 527 6e-15 BLAST
WD40 542 583 1.42e2 SMART
low complexity region 591 602 N/A INTRINSIC
Blast:WD40 603 646 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000041100
SMART Domains Protein: ENSMUSP00000040403
Gene: ENSMUSG00000039754

DomainStartEndE-ValueType
low complexity region 252 263 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125923
Predicted Effect probably benign
Transcript: ENSMUST00000128255
SMART Domains Protein: ENSMUSP00000119546
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
Blast:WD40 13 66 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132976
Predicted Effect probably benign
Transcript: ENSMUST00000136634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139908
Predicted Effect probably benign
Transcript: ENSMUST00000143229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149673
Predicted Effect probably benign
Transcript: ENSMUST00000150406
SMART Domains Protein: ENSMUSP00000121513
Gene: ENSMUSG00000029703

DomainStartEndE-ValueType
LRR_TYP 55 78 3.16e-3 SMART
LRR 99 122 1.58e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199786
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with components of the origin recognition complex (ORC) and regulates the formation of the prereplicative complex. The encoded protein stabilizes the ORC and therefore aids in DNA replication. This protein is required for the G1/S phase transition of the cell cycle. In addition, the encoded protein binds to trimethylated histone H3 in heterochromatin and recruits the ORC and lysine methyltransferases, which help maintain the repressive heterochromatic state. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik A T 8: 124,839,868 I271N probably damaging Het
5031439G07Rik A G 15: 84,953,276 Y279H probably damaging Het
Abcg2 T A 6: 58,685,817 M548K probably damaging Het
Acat1 T C 9: 53,589,225 D257G possibly damaging Het
Adamts4 G A 1: 171,253,183 G360R probably damaging Het
Akr1c12 T C 13: 4,272,329 D238G probably damaging Het
Ankrd1 C T 19: 36,115,003 G275S probably damaging Het
Ascc3 T A 10: 50,604,794 M1K probably null Het
Atf7ip2 T C 16: 10,240,608 S304P possibly damaging Het
Casp4 T A 9: 5,328,518 C333* probably null Het
Ccdc68 G A 18: 69,938,962 V37M probably damaging Het
Cda T A 4: 138,351,191 I87F probably damaging Het
Chst1 A T 2: 92,613,519 D112V probably damaging Het
Chtf18 T C 17: 25,719,158 D967G probably damaging Het
Col5a1 A G 2: 28,005,236 R1106G probably damaging Het
Coro1b T G 19: 4,149,377 F12V probably damaging Het
Ctif G T 18: 75,521,678 P259Q probably benign Het
Duox1 A T 2: 122,347,279 I1515F probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Flt1 A G 5: 147,564,240 Y1328H possibly damaging Het
Frem2 T C 3: 53,655,538 D516G probably benign Het
Gin1 A T 1: 97,775,589 K46* probably null Het
Gle1 C G 2: 29,952,552 probably null Het
Gm11146 T G 16: 77,602,082 I5L unknown Het
Gm597 A T 1: 28,776,340 D870E probably benign Het
Gpr153 C T 4: 152,279,943 T152M probably damaging Het
H1foo A T 6: 115,947,649 R39* probably null Het
Hdlbp A T 1: 93,423,385 probably null Het
Ifi207 A T 1: 173,735,295 L95Q possibly damaging Het
Ikzf3 G T 11: 98,516,920 P32T probably benign Het
Ints10 T A 8: 68,827,312 V697E probably damaging Het
Krt14 A G 11: 100,203,347 S474P probably damaging Het
L3mbtl3 T A 10: 26,327,769 I388F unknown Het
Ldha A C 7: 46,847,639 Q7P probably damaging Het
Med1 G T 11: 98,157,449 D840E possibly damaging Het
Med23 T A 10: 24,888,422 probably null Het
Naip5 G A 13: 100,221,591 P1046S possibly damaging Het
Ndufa4l2 A T 10: 127,515,432 M31L probably benign Het
Nlrp4f A G 13: 65,194,557 S425P possibly damaging Het
Nova1 A T 12: 46,720,798 H113Q unknown Het
Npc1 T C 18: 12,195,085 K1056E probably benign Het
Nrbp1 A G 5: 31,249,889 H354R probably benign Het
Ogfod3 A G 11: 121,183,474 F250L probably damaging Het
Pclo A G 5: 14,681,633 D3383G unknown Het
Pde1b T A 15: 103,527,599 D457E probably benign Het
Pkd1 C G 17: 24,568,236 S581R probably benign Het
Pno1 T A 11: 17,204,545 Q212L probably benign Het
Polr3b C T 10: 84,632,486 P112L probably damaging Het
Pomk T A 8: 25,983,074 I284F probably damaging Het
Rapgef4 A T 2: 72,045,160 D119V probably benign Het
Rprm A T 2: 54,085,153 L51Q probably benign Het
Taok3 A C 5: 117,199,043 S58R possibly damaging Het
Tmprss9 T A 10: 80,895,129 S830T probably benign Het
Tnfrsf1a G A 6: 125,356,916 C44Y probably damaging Het
Ubr5 A T 15: 38,041,479 D235E possibly damaging Het
Vapb C A 2: 173,771,537 F76L possibly damaging Het
Vmn2r72 T C 7: 85,738,257 I700V probably damaging Het
Wwc1 G A 11: 35,844,157 R964W probably damaging Het
Zfp644 A T 5: 106,634,899 V1203D probably damaging Het
Other mutations in Lrwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Lrwd1 APN 5 136134629 missense probably damaging 1.00
IGL01827:Lrwd1 APN 5 136131518 nonsense probably null
IGL01919:Lrwd1 APN 5 136135875 nonsense probably null
IGL02327:Lrwd1 APN 5 136123464 missense probably damaging 1.00
R0614:Lrwd1 UTSW 5 136123500 missense probably damaging 0.99
R0882:Lrwd1 UTSW 5 136123400 splice site probably null
R1137:Lrwd1 UTSW 5 136133419 missense probably benign 0.01
R1164:Lrwd1 UTSW 5 136130990 missense probably benign 0.00
R1838:Lrwd1 UTSW 5 136132388 missense probably benign 0.00
R2114:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2116:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2117:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R4514:Lrwd1 UTSW 5 136131548 missense probably benign 0.00
R4595:Lrwd1 UTSW 5 136123956 missense probably benign
R5304:Lrwd1 UTSW 5 136131150 missense possibly damaging 0.49
R5384:Lrwd1 UTSW 5 136123874 missense possibly damaging 0.84
R5719:Lrwd1 UTSW 5 136132239 splice site probably null
R5771:Lrwd1 UTSW 5 136123662 missense possibly damaging 0.95
R5791:Lrwd1 UTSW 5 136131033 missense probably benign 0.44
R6431:Lrwd1 UTSW 5 136133034 missense possibly damaging 0.90
R7074:Lrwd1 UTSW 5 136123657 missense probably benign 0.01
R7132:Lrwd1 UTSW 5 136123275 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GCTGTTGTTTCTGCTATGACACTGC -3'
(R):5'- TGCATAAACTCAGGTGATGCCCAAG -3'

Sequencing Primer
(F):5'- TTCCAGGTGTAGGGCAGC -3'
(R):5'- ccatcaagaaccaaagagagaaag -3'
Posted On2014-02-18