Incidental Mutation 'R0448:Olfr130'
ID158497
Institutional Source Beutler Lab
Gene Symbol Olfr130
Ensembl Gene ENSMUSG00000094878
Gene Nameolfactory receptor 130
SynonymsGA_x6K02T2PSCP-2515350-2516303, MOR256-19
MMRRC Submission 038648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R0448 (G1)
Quality Score56
Status Validated
Chromosome17
Chromosomal Location38063921-38072790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38067672 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 167 (R167L)
Ref Sequence ENSEMBL: ENSMUSP00000149601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087129] [ENSMUST00000215726] [ENSMUST00000217390]
Predicted Effect probably benign
Transcript: ENSMUST00000087129
AA Change: R167L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084369
Gene: ENSMUSG00000094878
AA Change: R167L

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 223 1.9e-5 PFAM
Pfam:7tm_1 40 289 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215726
AA Change: R167L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217390
AA Change: R167L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Add2 G A 6: 86,092,919 V140I probably benign Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brcc3 T A X: 75,450,041 L222* probably null Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp2j6 A G 4: 96,545,728 V115A probably benign Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Nup153 T C 13: 46,717,181 E86G probably benign Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pggt1b A T 18: 46,262,972 probably benign Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a11 T C 11: 70,645,579 N134S probably benign Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sorl1 C G 9: 42,004,088 V1282L probably damaging Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Olfr130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr130 APN 17 38068095 missense probably benign
IGL02158:Olfr130 APN 17 38067267 missense probably damaging 0.97
IGL03172:Olfr130 APN 17 38067384 missense probably damaging 0.99
R0389:Olfr130 UTSW 17 38067671 missense possibly damaging 0.58
R0616:Olfr130 UTSW 17 38067240 missense probably damaging 1.00
R0961:Olfr130 UTSW 17 38067923 missense probably damaging 1.00
R1789:Olfr130 UTSW 17 38067948 missense probably damaging 1.00
R2108:Olfr130 UTSW 17 38067855 missense possibly damaging 0.82
R4600:Olfr130 UTSW 17 38067962 missense probably damaging 0.99
R4977:Olfr130 UTSW 17 38067747 missense possibly damaging 0.67
R5120:Olfr130 UTSW 17 38067266 missense probably damaging 0.97
R5930:Olfr130 UTSW 17 38067750 missense probably benign 0.11
R6273:Olfr130 UTSW 17 38067795 missense probably damaging 1.00
R6636:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R6637:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
X0019:Olfr130 UTSW 17 38067722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGCCACAGGCTGTGCTATTC -3'
(R):5'- TTTACCCCAGGTTAGAGCTGACCG -3'

Sequencing Primer
(F):5'- GGGTCCACTGAATGTGTCCTC -3'
(R):5'- GTTAGAGCTGACCGTAACCTC -3'
Posted On2014-02-20