Incidental Mutation 'R0067:Scamp1'
ID158517
Institutional Source Beutler Lab
Gene Symbol Scamp1
Ensembl Gene ENSMUSG00000021687
Gene Namesecretory carrier membrane protein 1
Synonyms
MMRRC Submission 038358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0067 (G1)
Quality Score74
Status Validated
Chromosome13
Chromosomal Location94201310-94285857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94204150 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 237 (Y237C)
Ref Sequence ENSEMBL: ENSMUSP00000120053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022197] [ENSMUST00000152555] [ENSMUST00000153558]
Predicted Effect probably damaging
Transcript: ENSMUST00000022197
AA Change: Y289C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022197
Gene: ENSMUSG00000021687
AA Change: Y289C

DomainStartEndE-ValueType
coiled coil region 75 114 N/A INTRINSIC
Pfam:SCAMP 117 292 7.4e-74 PFAM
low complexity region 314 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152555
AA Change: Y237C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123135
Gene: ENSMUSG00000021687
AA Change: Y237C

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153558
AA Change: Y237C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120053
Gene: ENSMUSG00000021687
AA Change: Y237C

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities, but final cell capacitance of mast cells completing exocytosis was smaller than controls and an increased proportion of reversible fusion events was noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C T 7: 28,911,570 V248M possibly damaging Het
Adamts9 T A 6: 92,890,167 K79N probably damaging Het
AW209491 A T 13: 14,637,743 I394F probably benign Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1d A T 14: 30,075,010 probably benign Het
Cacna1i A T 15: 80,381,172 I1542F probably damaging Het
Cep97 A T 16: 55,915,561 N291K possibly damaging Het
Clasp2 A T 9: 113,860,141 probably benign Het
Coq8b T C 7: 27,233,481 L5P possibly damaging Het
Dennd1c T C 17: 57,075,465 Q67R probably damaging Het
Dysf T C 6: 84,063,331 V119A possibly damaging Het
Eml1 A G 12: 108,463,527 D23G possibly damaging Het
Eva1c A T 16: 90,866,417 D13V possibly damaging Het
Fam151b T C 13: 92,473,996 K95R probably benign Het
Glo1 A T 17: 30,594,271 probably null Het
Gm11360 T A 13: 27,956,231 M26K probably benign Het
Gps2 C T 11: 69,914,781 Q42* probably null Het
Gypa A G 8: 80,503,081 H102R possibly damaging Het
Hdac4 G A 1: 92,029,984 H103Y probably damaging Het
Hivep1 T A 13: 42,158,656 D1457E probably benign Het
Hunk A G 16: 90,447,312 D110G probably damaging Het
L3mbtl1 A G 2: 162,948,828 K225E probably damaging Het
Limch1 A G 5: 66,974,622 S143G probably damaging Het
Macf1 T C 4: 123,475,248 K342E possibly damaging Het
Mc5r T A 18: 68,339,566 M332K probably damaging Het
Memo1 A G 17: 74,225,458 V185A probably damaging Het
Myf6 A T 10: 107,493,479 probably null Het
Myh14 G A 7: 44,623,127 T1418I probably benign Het
Pbk G A 14: 65,815,226 V173I possibly damaging Het
Plekha5 C T 6: 140,524,903 T90I probably damaging Het
Ptbp2 T C 3: 119,720,641 T478A probably benign Het
Rasgrp1 C A 2: 117,294,820 R246S probably damaging Het
Rflnb A T 11: 76,022,161 S134T possibly damaging Het
Rnf214 A G 9: 45,867,498 probably null Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rtn2 T A 7: 19,294,471 probably benign Het
Satb1 T C 17: 51,804,336 T165A probably damaging Het
Skint10 A T 4: 112,711,556 F321L probably benign Het
Skiv2l2 C T 13: 112,886,862 V727I probably benign Het
Slc36a2 A G 11: 55,162,640 probably benign Het
Slc8a1 A G 17: 81,437,759 V672A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spats2 C A 15: 99,212,287 P522T possibly damaging Het
Stkld1 A T 2: 26,949,340 E339D probably benign Het
Tbc1d9 A G 8: 83,234,243 T241A probably damaging Het
Ticrr A T 7: 79,677,410 D622V probably damaging Het
Tie1 A G 4: 118,476,280 probably benign Het
Trak1 G C 9: 121,472,907 V910L probably damaging Het
Trmt1l T C 1: 151,448,380 V326A probably benign Het
Tshr A G 12: 91,505,283 T136A probably damaging Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Unc13a A C 8: 71,634,658 F1482V probably damaging Het
Unc79 A G 12: 103,059,518 E388G probably damaging Het
Ush2a A T 1: 188,964,846 D5167V probably damaging Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy4 G A 14: 33,162,751 R65C probably null Het
Zcchc9 T C 13: 91,797,249 I72V probably benign Het
Zfc3h1 G T 10: 115,423,474 L1650F possibly damaging Het
Zzz3 A G 3: 152,428,403 D366G possibly damaging Het
Other mutations in Scamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Scamp1 APN 13 94204022 missense probably damaging 1.00
IGL02269:Scamp1 APN 13 94232186 splice site probably benign
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0254:Scamp1 UTSW 13 94210580 missense probably benign 0.00
R0367:Scamp1 UTSW 13 94210580 missense probably benign 0.01
R0559:Scamp1 UTSW 13 94208182 missense possibly damaging 0.79
R1147:Scamp1 UTSW 13 94224886 unclassified probably null
R1400:Scamp1 UTSW 13 94224947 missense possibly damaging 0.53
R1499:Scamp1 UTSW 13 94224929 missense probably benign 0.03
R5206:Scamp1 UTSW 13 94232107 missense probably damaging 1.00
R5259:Scamp1 UTSW 13 94232086 missense probably benign
R5300:Scamp1 UTSW 13 94204162 missense probably damaging 0.99
R6128:Scamp1 UTSW 13 94208227 missense possibly damaging 0.80
R7017:Scamp1 UTSW 13 94224915 missense probably damaging 0.98
R7219:Scamp1 UTSW 13 94224907 missense probably damaging 1.00
R7242:Scamp1 UTSW 13 94233140 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGCTTCCAGGCTCGCTACATC -3'
(R):5'- TAACCTGGTCTGCTTCGACCGAAC -3'

Sequencing Primer
(F):5'- ACATCTGGTTACCCTTGAAGGC -3'
(R):5'- TTCGACCGAACAGGGCAG -3'
Posted On2014-03-10