Incidental Mutation 'R0078:8030411F24Rik'
List |< first << previous [record 24 of 958] next >> last >|
ID158521
Institutional Source Beutler Lab
Gene Symbol 8030411F24Rik
Ensembl Gene ENSMUSG00000027444
Gene NameRIKEN cDNA 8030411F24 gene
Synonymscystatin SC
MMRRC Submission 038365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R0078 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location148782009-148785937 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 148785825 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 131 (*131K)
Ref Sequence ENSEMBL: ENSMUSP00000028933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028932] [ENSMUST00000028933] [ENSMUST00000168443]
Predicted Effect probably benign
Transcript: ENSMUST00000028932
SMART Domains Protein: ENSMUSP00000028932
Gene: ENSMUSG00000027443

DomainStartEndE-ValueType
CY 18 126 9.57e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000028933
AA Change: *131K
SMART Domains Protein: ENSMUSP00000028933
Gene: ENSMUSG00000027444
AA Change: *131K

DomainStartEndE-ValueType
CY 20 128 2.25e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168443
SMART Domains Protein: ENSMUSP00000126008
Gene: ENSMUSG00000027443

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CY 31 139 4.8e-5 SMART
Meta Mutation Damage Score 0.6332 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency 81% (203/250)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,927,394 Q456L probably benign Het
Abcf1 A G 17: 35,958,062 probably benign Het
Adamts7 A T 9: 90,179,411 S357C probably damaging Het
Ankrd26 A G 6: 118,535,069 probably benign Het
Asb17 T A 3: 153,844,664 V111E probably damaging Het
C1qtnf4 C A 2: 90,889,549 N55K probably damaging Het
C77080 T C 4: 129,227,723 probably null Het
Cacng5 G T 11: 107,877,433 D249E probably benign Het
Camkk2 C A 5: 122,757,559 probably null Het
Ccdc27 T G 4: 154,035,738 probably benign Het
Cngb1 T A 8: 95,264,545 probably null Het
Col7a1 A G 9: 108,974,913 probably benign Het
Corin T A 5: 72,454,473 D148V possibly damaging Het
Defb26 A C 2: 152,508,068 D97E possibly damaging Het
Dgkb A G 12: 38,136,541 N237D probably benign Het
Dsp A G 13: 38,196,017 N1647S probably benign Het
Dtna G A 18: 23,621,442 A438T probably damaging Het
Erbb3 G T 10: 128,583,441 F219L probably damaging Het
EU599041 G A 7: 43,225,851 noncoding transcript Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Fat4 T C 3: 38,888,931 S658P probably benign Het
Fgfr2 C T 7: 130,201,075 D168N possibly damaging Het
Fstl5 T A 3: 76,659,645 probably benign Het
Glmn C T 5: 107,557,970 V451I probably benign Het
Gm8909 A T 17: 36,165,461 S304T possibly damaging Het
Gm9938 T A 19: 23,724,624 probably benign Het
Gpat2 T C 2: 127,428,249 S61P probably damaging Het
Gpr22 T A 12: 31,711,641 M6L probably benign Het
Grm5 T C 7: 88,074,977 L825P probably damaging Het
Gstz1 A T 12: 87,159,703 I66F probably benign Het
H2-T22 A G 17: 36,040,609 V243A probably damaging Het
Hivep1 C T 13: 42,156,041 L586F probably damaging Het
Hmcn2 T G 2: 31,388,344 L1686R probably damaging Het
Ice1 T C 13: 70,603,348 R1540G probably damaging Het
Igha T A 12: 113,259,927 probably benign Het
Kif3a C A 11: 53,578,985 T141K probably benign Het
Knl1 G A 2: 119,069,892 M691I probably benign Het
L3mbtl1 T C 2: 162,947,226 V13A probably benign Het
Lamc1 T A 1: 153,229,190 N1282I probably damaging Het
Lemd2 G T 17: 27,203,728 L231I probably benign Het
Lrrk2 G A 15: 91,734,009 V904M probably benign Het
Lyzl6 C T 11: 103,633,969 S103N probably benign Het
Macf1 T A 4: 123,473,868 R2367W probably damaging Het
Mapk3 T C 7: 126,759,805 Y54H probably damaging Het
Mlh3 A T 12: 85,268,818 V198D probably damaging Het
Myocd T C 11: 65,187,464 S374G possibly damaging Het
Ngef T C 1: 87,540,665 E124G probably benign Het
Nr4a2 T C 2: 57,112,228 Y8C probably damaging Het
Nynrin T A 14: 55,863,332 V193D probably damaging Het
Olfr1280 A T 2: 111,315,904 I142F probably benign Het
Olfr1331 T A 4: 118,869,227 S148T probably benign Het
Olfr1490 G T 19: 13,654,815 V129F probably benign Het
Olfr215 A G 6: 116,582,740 S69P probably damaging Het
Olfr59 A T 11: 74,289,266 I207F probably damaging Het
Pcdh18 T C 3: 49,756,344 Y174C probably damaging Het
Pcf11 T C 7: 92,669,559 D21G possibly damaging Het
Pdia4 A C 6: 47,798,410 F489V possibly damaging Het
Pitrm1 C T 13: 6,575,032 P849S probably damaging Het
Plcz1 T C 6: 139,989,784 Y644C probably damaging Het
Ppp5c T C 7: 17,027,725 E28G probably benign Het
Prkcb A G 7: 122,590,170 Y507C probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Scarf1 A G 11: 75,515,162 probably benign Het
Scoc T A 8: 83,458,258 probably null Het
Sh2d4a A T 8: 68,282,321 M31L probably damaging Het
Spta1 T A 1: 174,207,032 probably benign Het
Stard7 A G 2: 127,292,207 Y270C probably damaging Het
Svs3b T C 2: 164,255,961 T147A probably benign Het
Tmtc3 A G 10: 100,448,961 L604P probably damaging Het
Trim30b A T 7: 104,365,895 N95K probably benign Het
Trpm8 C A 1: 88,328,148 probably benign Het
Tspan9 T C 6: 127,966,485 probably null Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Tyro3 A T 2: 119,817,006 Q872L probably damaging Het
Vmn1r204 G A 13: 22,556,209 M3I probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdfy3 A G 5: 101,888,105 I2149T possibly damaging Het
Wdr66 G A 5: 123,298,570 R1054H probably benign Het
Zfp668 A T 7: 127,868,038 M122K possibly damaging Het
Zkscan1 A T 5: 138,093,101 D32V probably damaging Het
Other mutations in 8030411F24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:8030411F24Rik APN 2 148782250 missense possibly damaging 0.93
IGL00936:8030411F24Rik APN 2 148785804 missense probably benign 0.05
IGL02353:8030411F24Rik APN 2 148783467 splice site probably benign
IGL03088:8030411F24Rik APN 2 148783407 missense possibly damaging 0.81
R0465:8030411F24Rik UTSW 2 148783425 missense probably benign 0.14
R0542:8030411F24Rik UTSW 2 148782172 missense probably benign
R0723:8030411F24Rik UTSW 2 148783362 missense probably damaging 0.98
R2025:8030411F24Rik UTSW 2 148782228 missense probably damaging 0.98
R5153:8030411F24Rik UTSW 2 148783440 missense probably benign 0.12
R5360:8030411F24Rik UTSW 2 148783378 missense probably damaging 1.00
R5362:8030411F24Rik UTSW 2 148783378 missense probably damaging 1.00
R5363:8030411F24Rik UTSW 2 148783378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTTGAATCCATTGTCCTCGTG -3'
(R):5'- CTGGCCCATACATACACTGCTTCAC -3'

Sequencing Primer
(F):5'- ATCCATTGTCCTCGTGGAGATTTG -3'
(R):5'- aaaaaaaaaCCAGCTTATCATTGAGG -3'
Posted On2014-03-11