Incidental Mutation 'R1443:Doxl2'
ID158647
Institutional Source Beutler Lab
Gene Symbol Doxl2
Ensembl Gene ENSMUSG00000068536
Gene Namediamine oxidase-like protein 2
Synonyms
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.030) question?
Stock #R1443 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location48974963-48978746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48975915 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 258 (Y258F)
Ref Sequence ENSEMBL: ENSMUSP00000087517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090063] [ENSMUST00000184917]
Predicted Effect probably damaging
Transcript: ENSMUST00000090063
AA Change: Y258F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087517
Gene: ENSMUSG00000068536
AA Change: Y258F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.5e-16 PFAM
Pfam:Cu_amine_oxid 298 708 1.3e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184852
SMART Domains Protein: ENSMUSP00000139236
Gene: ENSMUSG00000068536

DomainStartEndE-ValueType
Pfam:Cu_amine_oxid 15 212 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184917
AA Change: Y258F

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139012
Gene: ENSMUSG00000068536
AA Change: Y258F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 1.1e-21 PFAM
Pfam:Cu_amine_oxidN3 146 246 3.1e-14 PFAM
Pfam:Cu_amine_oxid 298 711 1.4e-96 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Doxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Doxl2 APN 6 48978131 missense possibly damaging 0.82
IGL00985:Doxl2 APN 6 48977547 missense probably benign
IGL01556:Doxl2 APN 6 48975684 missense possibly damaging 0.58
IGL02083:Doxl2 APN 6 48976260 missense probably damaging 1.00
IGL02135:Doxl2 APN 6 48975564 missense probably benign 0.11
IGL02744:Doxl2 APN 6 48975315 missense probably benign 0.15
IGL03005:Doxl2 APN 6 48976546 nonsense probably null
R0306:Doxl2 UTSW 6 48976086 missense probably damaging 1.00
R0380:Doxl2 UTSW 6 48975839 missense probably benign
R0598:Doxl2 UTSW 6 48975537 missense probably benign 0.36
R0948:Doxl2 UTSW 6 48976344 missense probably damaging 1.00
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1404:Doxl2 UTSW 6 48975833 missense probably benign 0.03
R1432:Doxl2 UTSW 6 48975654 missense probably damaging 1.00
R1535:Doxl2 UTSW 6 48975464 missense probably damaging 0.98
R1625:Doxl2 UTSW 6 48975171 missense probably damaging 1.00
R1872:Doxl2 UTSW 6 48975620 missense probably benign 0.00
R1960:Doxl2 UTSW 6 48975753 missense probably damaging 1.00
R2031:Doxl2 UTSW 6 48975855 missense probably damaging 0.99
R2049:Doxl2 UTSW 6 48977755 nonsense probably null
R2086:Doxl2 UTSW 6 48977602 missense probably damaging 1.00
R2144:Doxl2 UTSW 6 48975291 missense probably benign 0.00
R2145:Doxl2 UTSW 6 48976695 missense probably damaging 1.00
R2152:Doxl2 UTSW 6 48976539 missense probably damaging 1.00
R2255:Doxl2 UTSW 6 48975957 missense possibly damaging 0.75
R2973:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R2974:Doxl2 UTSW 6 48976424 missense probably benign 0.07
R3125:Doxl2 UTSW 6 48975371 missense probably damaging 1.00
R4321:Doxl2 UTSW 6 48976522 missense probably damaging 1.00
R4367:Doxl2 UTSW 6 48976130 missense probably damaging 1.00
R4532:Doxl2 UTSW 6 48978167 missense possibly damaging 0.77
R4575:Doxl2 UTSW 6 48977568 nonsense probably null
R4611:Doxl2 UTSW 6 48975156 missense probably benign 0.39
R4823:Doxl2 UTSW 6 48975261 missense probably damaging 1.00
R5320:Doxl2 UTSW 6 48975540 missense probably damaging 1.00
R5520:Doxl2 UTSW 6 48975794 missense possibly damaging 0.93
R5698:Doxl2 UTSW 6 48976322 missense possibly damaging 0.94
R5765:Doxl2 UTSW 6 48978537 missense probably damaging 1.00
R6024:Doxl2 UTSW 6 48976096 missense possibly damaging 0.71
R6061:Doxl2 UTSW 6 48976601 missense probably benign 0.02
R6268:Doxl2 UTSW 6 48977682 missense probably benign 0.01
R6564:Doxl2 UTSW 6 48977575 missense probably benign 0.00
R6640:Doxl2 UTSW 6 48977671 missense probably benign 0.21
X0013:Doxl2 UTSW 6 48977613 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGCGCATTGTAAAAGATCGCC -3'
(R):5'- TAGCACCTTGCACGCCAATCTC -3'

Sequencing Primer
(F):5'- CATTGTAAAAGATCGCCTGCTAC -3'
(R):5'- TTGCACGCCAATCTCATAGG -3'
Posted On2014-03-14