Incidental Mutation 'R1443:Lama4'
ID158659
Institutional Source Beutler Lab
Gene Symbol Lama4
Ensembl Gene ENSMUSG00000019846
Gene Namelaminin, alpha 4
Synonymslaminin [a]4
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1443 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location38965515-39110188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39073643 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 911 (E911K)
Ref Sequence ENSEMBL: ENSMUSP00000019992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019992]
Predicted Effect probably damaging
Transcript: ENSMUST00000019992
AA Change: E911K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019992
Gene: ENSMUSG00000019846
AA Change: E911K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EGF_Lam 82 129 1.95e-8 SMART
EGF_Lam 132 184 5.78e-11 SMART
EGF_Lam 187 238 9.83e-14 SMART
Pfam:Laminin_I 283 548 5.3e-71 PFAM
coiled coil region 658 685 N/A INTRINSIC
LamG 850 1009 9.54e-11 SMART
LamG 1066 1205 5.9e-25 SMART
LamG 1250 1374 6.68e-24 SMART
LamG 1484 1619 1.54e-37 SMART
LamG 1661 1794 3.63e-34 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcdhb17 A G 18: 37,486,648 Q497R probably benign Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Lama4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Lama4 APN 10 39065595 splice site probably benign
IGL00091:Lama4 APN 10 39072805 missense probably damaging 1.00
IGL00429:Lama4 APN 10 39011026 missense possibly damaging 0.58
IGL00430:Lama4 APN 10 39045704 missense possibly damaging 0.54
IGL01074:Lama4 APN 10 39098488 critical splice donor site probably null
IGL01386:Lama4 APN 10 39011064 missense probably benign 0.00
IGL01603:Lama4 APN 10 39065646 missense possibly damaging 0.92
IGL01643:Lama4 APN 10 39056850 missense probably benign
IGL01655:Lama4 APN 10 39060213 missense probably benign
IGL01954:Lama4 APN 10 39087299 missense probably benign 0.05
IGL01984:Lama4 APN 10 39075529 critical splice donor site probably null
IGL02193:Lama4 APN 10 39042674 missense probably benign
IGL02290:Lama4 APN 10 39017364 missense probably benign 0.00
IGL02441:Lama4 APN 10 39061445 missense probably benign 0.20
IGL02549:Lama4 APN 10 39060204 missense probably benign 0.00
IGL02797:Lama4 APN 10 39056924 missense probably null 0.00
IGL02819:Lama4 APN 10 39026569 missense possibly damaging 0.80
IGL03122:Lama4 APN 10 39067963 missense probably benign
IGL03184:Lama4 APN 10 39078843 missense probably damaging 1.00
IGL03307:Lama4 APN 10 39017383 missense probably benign
R0003:Lama4 UTSW 10 39060222 missense possibly damaging 0.55
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0035:Lama4 UTSW 10 39072738 missense probably benign 0.01
R0141:Lama4 UTSW 10 39092278 missense probably benign 0.05
R0257:Lama4 UTSW 10 39094884 splice site probably benign
R0267:Lama4 UTSW 10 39028639 missense probably damaging 0.96
R0557:Lama4 UTSW 10 39088397 missense probably benign 0.38
R1052:Lama4 UTSW 10 39092245 missense possibly damaging 0.68
R1248:Lama4 UTSW 10 39056847 missense probably damaging 0.99
R1249:Lama4 UTSW 10 39075478 missense probably damaging 1.00
R1291:Lama4 UTSW 10 39048069 missense probably benign 0.00
R1307:Lama4 UTSW 10 39070032 missense probably benign 0.06
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1499:Lama4 UTSW 10 39088880 missense possibly damaging 0.92
R1616:Lama4 UTSW 10 39075450 missense probably damaging 1.00
R1691:Lama4 UTSW 10 39080563 missense probably benign 0.09
R1748:Lama4 UTSW 10 39065619 missense probably benign 0.01
R1768:Lama4 UTSW 10 39103501 missense possibly damaging 0.82
R1772:Lama4 UTSW 10 39060224 missense probably benign 0.00
R1813:Lama4 UTSW 10 39033125 splice site probably benign
R1813:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1897:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1907:Lama4 UTSW 10 39072758 missense probably benign 0.13
R1943:Lama4 UTSW 10 39097138 missense possibly damaging 0.85
R2041:Lama4 UTSW 10 39069991 missense probably damaging 1.00
R2242:Lama4 UTSW 10 39026693 missense probably damaging 1.00
R2300:Lama4 UTSW 10 39087320 missense probably benign
R2326:Lama4 UTSW 10 39042567 splice site probably null
R2570:Lama4 UTSW 10 39075358 missense possibly damaging 0.94
R2570:Lama4 UTSW 10 39106047 missense probably damaging 1.00
R2571:Lama4 UTSW 10 39042675 missense possibly damaging 0.55
R2887:Lama4 UTSW 10 39092254 missense possibly damaging 0.94
R2926:Lama4 UTSW 10 39078832 missense probably benign 0.16
R3237:Lama4 UTSW 10 39097179 missense probably damaging 0.97
R4095:Lama4 UTSW 10 39097122 missense probably damaging 1.00
R4151:Lama4 UTSW 10 39005428 missense probably benign 0.00
R4470:Lama4 UTSW 10 39080496 nonsense probably null
R4812:Lama4 UTSW 10 39072769 missense probably benign
R4822:Lama4 UTSW 10 39033053 missense probably benign 0.01
R4997:Lama4 UTSW 10 39092266 missense probably damaging 0.99
R5119:Lama4 UTSW 10 39048054 missense probably benign 0.00
R5468:Lama4 UTSW 10 39072682 intron probably null
R5909:Lama4 UTSW 10 39072859 missense probably benign 0.00
R5917:Lama4 UTSW 10 39048032 missense probably benign 0.10
R5927:Lama4 UTSW 10 39072812 missense probably damaging 1.00
R5950:Lama4 UTSW 10 39030448 missense probably benign 0.03
R6051:Lama4 UTSW 10 39067902 missense probably benign 0.01
R6277:Lama4 UTSW 10 39106010 missense probably damaging 1.00
R6294:Lama4 UTSW 10 39075470 missense probably damaging 1.00
R6372:Lama4 UTSW 10 39067952 missense probably benign
R6532:Lama4 UTSW 10 39048077 missense possibly damaging 0.58
R6547:Lama4 UTSW 10 39073656 missense probably damaging 1.00
R6578:Lama4 UTSW 10 39017365 missense probably benign 0.01
R6737:Lama4 UTSW 10 39094911 missense probably damaging 0.96
R6987:Lama4 UTSW 10 39074279 missense probably benign 0.00
X0067:Lama4 UTSW 10 39045692 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGTCAAGGTACGTGATGCCTCTG -3'
(R):5'- ATCTCACTCCGGTGTTTGGGAAGG -3'

Sequencing Primer
(F):5'- CTGACTACAGCAGCTTTTAGGAC -3'
(R):5'- CCGGTGTTTGGGAAGGAATATAG -3'
Posted On2014-03-14