Incidental Mutation 'R1443:Pcdhb17'
ID158684
Institutional Source Beutler Lab
Gene Symbol Pcdhb17
Ensembl Gene ENSMUSG00000046387
Gene Nameprotocadherin beta 17
SynonymsPcdhbQ, Pcdhb16
MMRRC Submission 039498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1443 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37484795-37489454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37486648 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 497 (Q497R)
Ref Sequence ENSEMBL: ENSMUSP00000055072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051442] [ENSMUST00000053856] [ENSMUST00000055949] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053856
AA Change: Q497R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000055072
Gene: ENSMUSG00000046387
AA Change: Q497R

DomainStartEndE-ValueType
Pfam:Cadherin_2 31 112 5.8e-35 PFAM
CA 155 240 2.42e-18 SMART
CA 264 345 8.03e-24 SMART
CA 368 449 5.81e-21 SMART
CA 473 559 8.15e-25 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 770 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.2%
  • 20x: 85.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,262,798 S56R probably damaging Het
Actr8 A G 14: 29,984,099 M99V possibly damaging Het
Adamtsl2 T A 2: 27,103,066 C703S possibly damaging Het
Afap1 G T 5: 35,968,661 K333N probably damaging Het
Aldh3a2 G A 11: 61,264,307 S137L probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aoc1 A T 6: 48,905,445 K107M possibly damaging Het
Bmp8a G T 4: 123,316,965 S252R possibly damaging Het
C7 T C 15: 5,059,419 I13M probably benign Het
Cblb T A 16: 52,139,611 D322E possibly damaging Het
Cfap54 G A 10: 92,932,721 T180I probably damaging Het
Clrn2 C T 5: 45,460,111 A108V probably damaging Het
Cspg4 T A 9: 56,886,512 D510E probably damaging Het
Cyp2c40 A T 19: 39,777,971 N393K possibly damaging Het
Dcaf5 T C 12: 80,364,069 Y294C probably damaging Het
Dclk3 T A 9: 111,469,020 M544K probably benign Het
Doxl2 A T 6: 48,975,915 Y258F probably damaging Het
Ell3 A T 2: 121,439,465 F388I probably damaging Het
Fam208b T C 13: 3,575,543 K1469R probably benign Het
Fam78b A G 1: 167,078,760 I163V probably damaging Het
Gnptab T C 10: 88,434,081 L882P probably damaging Het
Herc2 A T 7: 56,204,733 D3802V possibly damaging Het
Hs3st5 A G 10: 36,833,414 E315G probably benign Het
Idh3b A T 2: 130,284,054 probably null Het
Lama4 G A 10: 39,073,643 E911K probably damaging Het
Macf1 A G 4: 123,511,007 I436T probably damaging Het
Mgam C A 6: 40,759,780 S871* probably null Het
Mtmr7 A G 8: 40,560,882 S212P probably damaging Het
Mylk2 A G 2: 152,919,416 T480A probably damaging Het
Myo3a A T 2: 22,282,626 N191I probably damaging Het
Nanog C T 6: 122,711,775 S105F probably damaging Het
Nanos2 A G 7: 18,987,639 Y12C probably damaging Het
Nsg1 C T 5: 38,155,643 V71I probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr1458 G T 19: 13,103,204 Y33* probably null Het
Olfr1512 A T 14: 52,372,951 I34N probably damaging Het
Olfr211 T C 6: 116,494,425 L272S probably benign Het
Olfr643 A T 7: 104,058,723 I293N probably damaging Het
Pcsk7 C A 9: 45,925,986 P536Q probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Phyhip A G 14: 70,467,291 K317E probably damaging Het
Pkhd1 C T 1: 20,534,558 G1178R probably damaging Het
Ppp1r9a G A 6: 5,057,557 G544D probably damaging Het
Ptpn3 T C 4: 57,225,775 D480G probably benign Het
Ptprn2 A T 12: 117,253,615 K918N probably damaging Het
Rab42 T C 4: 132,302,347 D188G probably benign Het
Rasgrf2 C A 13: 91,983,676 D20Y probably damaging Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sbpl T C 17: 23,953,354 K197R unknown Het
Slc44a1 T A 4: 53,561,069 V595E probably damaging Het
Slc6a19 A G 13: 73,684,344 M410T probably damaging Het
Sntb1 A T 15: 55,647,955 L411H probably damaging Het
Synj2 A G 17: 6,023,665 K245E probably damaging Het
Tmem131 G A 1: 36,825,478 T558I probably damaging Het
Tnrc18 A T 5: 142,771,533 S1078T unknown Het
Trmu T A 15: 85,897,101 probably null Het
Ttn A T 2: 76,891,086 probably benign Het
Tyw3 T C 3: 154,587,523 T172A probably benign Het
Vldlr T C 19: 27,239,721 I348T possibly damaging Het
Zfp114 A G 7: 24,177,769 D12G probably damaging Het
Other mutations in Pcdhb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Pcdhb17 APN 18 37486006 unclassified probably null
IGL01367:Pcdhb17 APN 18 37487495 missense probably benign 0.01
IGL01923:Pcdhb17 APN 18 37486737 missense probably benign 0.43
IGL02060:Pcdhb17 APN 18 37486416 missense probably damaging 1.00
IGL02494:Pcdhb17 APN 18 37485294 missense possibly damaging 0.73
IGL02654:Pcdhb17 APN 18 37486561 missense probably benign 0.03
IGL03168:Pcdhb17 APN 18 37485772 missense probably benign 0.15
doughnut UTSW 18 37486936 missense probably damaging 1.00
R0364:Pcdhb17 UTSW 18 37485835 missense possibly damaging 0.95
R1013:Pcdhb17 UTSW 18 37485967 missense probably damaging 1.00
R1052:Pcdhb17 UTSW 18 37486846 missense probably damaging 1.00
R1226:Pcdhb17 UTSW 18 37487260 missense probably damaging 1.00
R1258:Pcdhb17 UTSW 18 37485534 missense probably damaging 0.98
R1335:Pcdhb17 UTSW 18 37486234 missense probably damaging 1.00
R1451:Pcdhb17 UTSW 18 37486936 missense probably damaging 1.00
R1505:Pcdhb17 UTSW 18 37486822 missense probably damaging 1.00
R1591:Pcdhb17 UTSW 18 37485825 missense probably damaging 1.00
R1742:Pcdhb17 UTSW 18 37486576 missense probably damaging 0.99
R1750:Pcdhb17 UTSW 18 37485711 missense probably damaging 1.00
R1750:Pcdhb17 UTSW 18 37487017 missense possibly damaging 0.81
R1764:Pcdhb17 UTSW 18 37487271 missense probably damaging 1.00
R1863:Pcdhb17 UTSW 18 37486111 missense probably benign 0.00
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R1888:Pcdhb17 UTSW 18 37487385 unclassified probably null
R2095:Pcdhb17 UTSW 18 37486322 missense probably benign 0.14
R4565:Pcdhb17 UTSW 18 37486470 missense probably benign 0.14
R4658:Pcdhb17 UTSW 18 37486599 missense probably damaging 1.00
R4669:Pcdhb17 UTSW 18 37486206 missense probably damaging 0.99
R4816:Pcdhb17 UTSW 18 37487397 missense probably benign 0.39
R4910:Pcdhb17 UTSW 18 37485159 start codon destroyed possibly damaging 0.90
R5209:Pcdhb17 UTSW 18 37487461 missense probably damaging 1.00
R5248:Pcdhb17 UTSW 18 37485886 missense probably benign 0.00
R5254:Pcdhb17 UTSW 18 37486825 missense probably damaging 1.00
R5494:Pcdhb17 UTSW 18 37487247 missense probably damaging 1.00
R5544:Pcdhb17 UTSW 18 37487421 missense possibly damaging 0.61
R5952:Pcdhb17 UTSW 18 37487080 missense probably benign 0.04
R5977:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6262:Pcdhb17 UTSW 18 37486698 missense probably damaging 1.00
R6311:Pcdhb17 UTSW 18 37486263 unclassified probably null
R6495:Pcdhb17 UTSW 18 37485667 missense probably damaging 1.00
R6710:Pcdhb17 UTSW 18 37485399 missense probably damaging 0.96
X0062:Pcdhb17 UTSW 18 37486489 missense probably benign
X0064:Pcdhb17 UTSW 18 37486431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATGCTATCTGCTCTTACCAGCC -3'
(R):5'- TGTCATTGTCGTCCAGCACCAC -3'

Sequencing Primer
(F):5'- TGATTGCCTCCATCGAAGAAG -3'
(R):5'- TTGGTCTATTGCACCCACGT -3'
Posted On2014-03-14