Incidental Mutation 'R1444:Erbb4'
ID158689
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission 039499-MU
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1444 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68254600 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 711 (R711C)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: R711C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: R711C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: R711C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: R711C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153432
AA Change: R701C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: R701C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Meta Mutation Damage Score 0.488 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (59/60)
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,386 D347V probably damaging Het
4932431P20Rik T C 7: 29,529,955 noncoding transcript Het
A630010A05Rik T A 16: 14,609,694 F82I possibly damaging Het
Acad9 T A 3: 36,078,508 F297L possibly damaging Het
Adgrl3 A T 5: 81,512,353 Y323F probably damaging Het
Brca2 T A 5: 150,542,450 M1893K probably benign Het
Cactin A T 10: 81,322,436 probably null Het
Cadm4 A G 7: 24,503,621 *389W probably null Het
Calr4 A G 4: 109,246,241 T183A possibly damaging Het
Card10 A T 15: 78,787,841 probably benign Het
Cdh6 C A 15: 13,091,838 G14C probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cr1l A T 1: 195,131,202 L35Q probably damaging Het
Daam2 T C 17: 49,480,751 R445G possibly damaging Het
Ddn G A 15: 98,806,604 T269M probably damaging Het
Epb41 G A 4: 132,006,071 S176L probably benign Het
Ephx2 T C 14: 66,107,320 D167G probably damaging Het
Flg2 T A 3: 93,202,313 H549Q unknown Het
Gje1 A G 10: 14,716,636 probably null Het
Heatr5b G A 17: 78,753,193 H2018Y probably benign Het
Heatr5b A T 17: 78,755,427 probably benign Het
Hectd3 G T 4: 116,996,396 R189L probably benign Het
Hsd3b6 T C 3: 98,807,921 T52A probably benign Het
Il10rb T G 16: 91,421,787 probably null Het
Kcnc2 T C 10: 112,455,601 probably benign Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lrit1 T C 14: 37,061,971 F419L probably benign Het
Mmp8 T C 9: 7,567,263 C422R probably benign Het
Myo18b A G 5: 112,775,251 probably null Het
Ncor1 T A 11: 62,403,806 I280F probably damaging Het
Obox2 A C 7: 15,397,032 Q63P possibly damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr462 T A 11: 87,889,759 I46L probably benign Het
Phldb2 T A 16: 45,757,253 probably benign Het
Pkd1l1 A G 11: 8,854,386 F1735S probably damaging Het
Pramef6 G T 4: 143,896,891 L238I probably benign Het
Prss30 T C 17: 23,973,738 Y156C probably damaging Het
Rnf213 T C 11: 119,442,400 S2812P probably damaging Het
Rttn A G 18: 89,042,867 D1053G probably benign Het
Slc6a2 A G 8: 92,971,254 N120S probably damaging Het
Snrnp200 T C 2: 127,228,238 probably benign Het
Spindoc G T 19: 7,382,721 D27E probably benign Het
Svep1 T C 4: 58,115,754 T980A possibly damaging Het
Tgfbr1 A G 4: 47,393,259 E46G probably benign Het
Tmem183a T C 1: 134,361,546 I49V probably benign Het
Tmem212 C T 3: 27,885,095 V81I possibly damaging Het
Toporsl T A 4: 52,610,254 I49N probably benign Het
Trim67 A G 8: 124,823,193 T521A probably benign Het
Vsnl1 T C 12: 11,332,218 probably null Het
Xrn2 C T 2: 147,061,488 R803W probably damaging Het
Zfp131 A T 13: 119,790,248 C9S probably damaging Het
Zfp750 C T 11: 121,512,047 S625N probably damaging Het
Zfp871 G T 17: 32,774,926 T406N possibly damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGGGCATTGCATGGACTCTACTG -3'
(R):5'- CTCAACCAGACCAAGAACAGGTGTG -3'

Sequencing Primer
(F):5'- ggggtgaggtagtggtgg -3'
(R):5'- CAGGTGTGGACACAGGATG -3'
Posted On2014-03-14