Incidental Mutation 'R1444:Tmem183a'
ID158690
Institutional Source Beutler Lab
Gene Symbol Tmem183a
Ensembl Gene ENSMUSG00000042305
Gene Nametransmembrane protein 183A
Synonyms1300007B12Rik
MMRRC Submission 039499-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R1444 (G1)
Quality Score158
Status Validated
Chromosome1
Chromosomal Location134346097-134361979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134361546 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 49 (I49V)
Ref Sequence ENSEMBL: ENSMUSP00000141012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049470] [ENSMUST00000185903] [ENSMUST00000191237]
Predicted Effect probably benign
Transcript: ENSMUST00000049470
AA Change: I63V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046786
Gene: ENSMUSG00000042305
AA Change: I63V

DomainStartEndE-ValueType
low complexity region 110 122 N/A INTRINSIC
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185903
AA Change: I49V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141012
Gene: ENSMUSG00000042305
AA Change: I49V

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188205
Predicted Effect probably benign
Transcript: ENSMUST00000191237
AA Change: I63V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139821
Gene: ENSMUSG00000042305
AA Change: I63V

DomainStartEndE-ValueType
low complexity region 110 122 N/A INTRINSIC
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,386 D347V probably damaging Het
4932431P20Rik T C 7: 29,529,955 noncoding transcript Het
A630010A05Rik T A 16: 14,609,694 F82I possibly damaging Het
Acad9 T A 3: 36,078,508 F297L possibly damaging Het
Adgrl3 A T 5: 81,512,353 Y323F probably damaging Het
Brca2 T A 5: 150,542,450 M1893K probably benign Het
Cactin A T 10: 81,322,436 probably null Het
Cadm4 A G 7: 24,503,621 *389W probably null Het
Calr4 A G 4: 109,246,241 T183A possibly damaging Het
Card10 A T 15: 78,787,841 probably benign Het
Cdh6 C A 15: 13,091,838 G14C probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cr1l A T 1: 195,131,202 L35Q probably damaging Het
Daam2 T C 17: 49,480,751 R445G possibly damaging Het
Ddn G A 15: 98,806,604 T269M probably damaging Het
Epb41 G A 4: 132,006,071 S176L probably benign Het
Ephx2 T C 14: 66,107,320 D167G probably damaging Het
Erbb4 G A 1: 68,254,600 R711C probably damaging Het
Flg2 T A 3: 93,202,313 H549Q unknown Het
Gje1 A G 10: 14,716,636 probably null Het
Heatr5b G A 17: 78,753,193 H2018Y probably benign Het
Heatr5b A T 17: 78,755,427 probably benign Het
Hectd3 G T 4: 116,996,396 R189L probably benign Het
Hsd3b6 T C 3: 98,807,921 T52A probably benign Het
Il10rb T G 16: 91,421,787 probably null Het
Kcnc2 T C 10: 112,455,601 probably benign Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lrit1 T C 14: 37,061,971 F419L probably benign Het
Mmp8 T C 9: 7,567,263 C422R probably benign Het
Myo18b A G 5: 112,775,251 probably null Het
Ncor1 T A 11: 62,403,806 I280F probably damaging Het
Obox2 A C 7: 15,397,032 Q63P possibly damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr462 T A 11: 87,889,759 I46L probably benign Het
Phldb2 T A 16: 45,757,253 probably benign Het
Pkd1l1 A G 11: 8,854,386 F1735S probably damaging Het
Pramef6 G T 4: 143,896,891 L238I probably benign Het
Prss30 T C 17: 23,973,738 Y156C probably damaging Het
Rnf213 T C 11: 119,442,400 S2812P probably damaging Het
Rttn A G 18: 89,042,867 D1053G probably benign Het
Slc6a2 A G 8: 92,971,254 N120S probably damaging Het
Snrnp200 T C 2: 127,228,238 probably benign Het
Spindoc G T 19: 7,382,721 D27E probably benign Het
Svep1 T C 4: 58,115,754 T980A possibly damaging Het
Tgfbr1 A G 4: 47,393,259 E46G probably benign Het
Tmem212 C T 3: 27,885,095 V81I possibly damaging Het
Toporsl T A 4: 52,610,254 I49N probably benign Het
Trim67 A G 8: 124,823,193 T521A probably benign Het
Vsnl1 T C 12: 11,332,218 probably null Het
Xrn2 C T 2: 147,061,488 R803W probably damaging Het
Zfp131 A T 13: 119,790,248 C9S probably damaging Het
Zfp750 C T 11: 121,512,047 S625N probably damaging Het
Zfp871 G T 17: 32,774,926 T406N possibly damaging Het
Other mutations in Tmem183a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Tmem183a APN 1 134350144 missense probably damaging 1.00
R0611:Tmem183a UTSW 1 134352377 missense probably damaging 1.00
R0987:Tmem183a UTSW 1 134352371 missense probably damaging 1.00
R1589:Tmem183a UTSW 1 134354706 missense probably damaging 0.96
R2007:Tmem183a UTSW 1 134350123 missense probably damaging 1.00
R4735:Tmem183a UTSW 1 134360882 missense probably damaging 0.96
R4900:Tmem183a UTSW 1 134348166 missense probably benign 0.15
R6103:Tmem183a UTSW 1 134348146 missense probably benign 0.02
R6296:Tmem183a UTSW 1 134361611 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGCTGATCCTGGCTACACAC -3'
(R):5'- TGAAGACGGTGACAACGCACTC -3'

Sequencing Primer
(F):5'- CTGGCTACACACACCCATC -3'
(R):5'- TCGGCAATCAACGGGAC -3'
Posted On2014-03-14