Incidental Mutation 'R1444:Snrnp200'
ID158693
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Namesmall nuclear ribonucleoprotein 200 (U5)
SynonymsHELIC2, U5-200KD, A330064G03Rik, Ascc3l1
MMRRC Submission 039499-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1444 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127208386-127240451 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 127228238 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103220]
Predicted Effect probably benign
Transcript: ENSMUST00000103220
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140868
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,386 D347V probably damaging Het
4932431P20Rik T C 7: 29,529,955 noncoding transcript Het
A630010A05Rik T A 16: 14,609,694 F82I possibly damaging Het
Acad9 T A 3: 36,078,508 F297L possibly damaging Het
Adgrl3 A T 5: 81,512,353 Y323F probably damaging Het
Brca2 T A 5: 150,542,450 M1893K probably benign Het
Cactin A T 10: 81,322,436 probably null Het
Cadm4 A G 7: 24,503,621 *389W probably null Het
Calr4 A G 4: 109,246,241 T183A possibly damaging Het
Card10 A T 15: 78,787,841 probably benign Het
Cdh6 C A 15: 13,091,838 G14C probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cr1l A T 1: 195,131,202 L35Q probably damaging Het
Daam2 T C 17: 49,480,751 R445G possibly damaging Het
Ddn G A 15: 98,806,604 T269M probably damaging Het
Epb41 G A 4: 132,006,071 S176L probably benign Het
Ephx2 T C 14: 66,107,320 D167G probably damaging Het
Erbb4 G A 1: 68,254,600 R711C probably damaging Het
Flg2 T A 3: 93,202,313 H549Q unknown Het
Gje1 A G 10: 14,716,636 probably null Het
Heatr5b G A 17: 78,753,193 H2018Y probably benign Het
Heatr5b A T 17: 78,755,427 probably benign Het
Hectd3 G T 4: 116,996,396 R189L probably benign Het
Hsd3b6 T C 3: 98,807,921 T52A probably benign Het
Il10rb T G 16: 91,421,787 probably null Het
Kcnc2 T C 10: 112,455,601 probably benign Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lrit1 T C 14: 37,061,971 F419L probably benign Het
Mmp8 T C 9: 7,567,263 C422R probably benign Het
Myo18b A G 5: 112,775,251 probably null Het
Ncor1 T A 11: 62,403,806 I280F probably damaging Het
Obox2 A C 7: 15,397,032 Q63P possibly damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr462 T A 11: 87,889,759 I46L probably benign Het
Phldb2 T A 16: 45,757,253 probably benign Het
Pkd1l1 A G 11: 8,854,386 F1735S probably damaging Het
Pramef6 G T 4: 143,896,891 L238I probably benign Het
Prss30 T C 17: 23,973,738 Y156C probably damaging Het
Rnf213 T C 11: 119,442,400 S2812P probably damaging Het
Rttn A G 18: 89,042,867 D1053G probably benign Het
Slc6a2 A G 8: 92,971,254 N120S probably damaging Het
Spindoc G T 19: 7,382,721 D27E probably benign Het
Svep1 T C 4: 58,115,754 T980A possibly damaging Het
Tgfbr1 A G 4: 47,393,259 E46G probably benign Het
Tmem183a T C 1: 134,361,546 I49V probably benign Het
Tmem212 C T 3: 27,885,095 V81I possibly damaging Het
Toporsl T A 4: 52,610,254 I49N probably benign Het
Trim67 A G 8: 124,823,193 T521A probably benign Het
Vsnl1 T C 12: 11,332,218 probably null Het
Xrn2 C T 2: 147,061,488 R803W probably damaging Het
Zfp131 A T 13: 119,790,248 C9S probably damaging Het
Zfp750 C T 11: 121,512,047 S625N probably damaging Het
Zfp871 G T 17: 32,774,926 T406N possibly damaging Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127230135 missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127232472 missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127214912 splice site probably benign
IGL01319:Snrnp200 APN 2 127230127 splice site probably benign
IGL01597:Snrnp200 APN 2 127238732 unclassified probably benign
IGL01631:Snrnp200 APN 2 127238824 unclassified probably benign
IGL01646:Snrnp200 APN 2 127222228 missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127232905 missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127237483 missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127229991 missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127229895 missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127216110 missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127217488 missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127218426 missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127216756 splice site probably benign
IGL03108:Snrnp200 APN 2 127238167 missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127230042 critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127233313 missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0057:Snrnp200 UTSW 2 127237907 missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127232982 missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127221814 missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127226145 splice site probably benign
R1175:Snrnp200 UTSW 2 127229077 missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127236817 missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127218411 missense probably benign 0.10
R1757:Snrnp200 UTSW 2 127232443 missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127216736 missense probably benign
R1808:Snrnp200 UTSW 2 127219027 critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127219028 critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127216175 missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127227048 missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127234984 missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127212403 missense possibly damaging 0.89
R2070:Snrnp200 UTSW 2 127237883 missense probably benign 0.00
R2892:Snrnp200 UTSW 2 127231777 missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127221882 missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127233099 splice site probably benign
R4028:Snrnp200 UTSW 2 127237566 missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127228016 missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127222217 missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127238753 missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127229102 missense probably benign
R4575:Snrnp200 UTSW 2 127235066 missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127226133 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127217414 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127227878 missense possibly damaging 0.89
R4729:Snrnp200 UTSW 2 127232937 missense probably damaging 0.99
R4828:Snrnp200 UTSW 2 127211607 missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127226370 nonsense probably null
R5213:Snrnp200 UTSW 2 127231741 missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127231687 missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127233066 missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127226013 missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127226087 missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127225135 missense probably damaging 1.00
R6207:Snrnp200 UTSW 2 127210735 missense probably benign 0.00
R6258:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6259:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6299:Snrnp200 UTSW 2 127222161 nonsense probably null
R6434:Snrnp200 UTSW 2 127238654 missense probably damaging 1.00
R6522:Snrnp200 UTSW 2 127221827 missense probably benign 0.12
R6647:Snrnp200 UTSW 2 127226452 missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127229165 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGAATCGAGCAGCAGTTGTCCTC -3'
(R):5'- AAGCACGTTGATCTGCAAAGAAGC -3'

Sequencing Primer
(F):5'- CCTCGTAGGACAGTCACTTGATG -3'
(R):5'- GACCGACTGCTCAAAGAAATTATCTG -3'
Posted On2014-03-14