Incidental Mutation 'R1444:Ephx2'
ID158731
Institutional Source Beutler Lab
Gene Symbol Ephx2
Ensembl Gene ENSMUSG00000022040
Gene Nameepoxide hydrolase 2, cytoplasmic
SynonymsEph2, sEP, sEH
MMRRC Submission 039499-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R1444 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66084374-66124500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66107320 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 167 (D167G)
Ref Sequence ENSEMBL: ENSMUSP00000153161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070515] [ENSMUST00000224698] [ENSMUST00000225309]
Predicted Effect probably damaging
Transcript: ENSMUST00000070515
AA Change: D185G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069209
Gene: ENSMUSG00000022040
AA Change: D185G

DomainStartEndE-ValueType
Pfam:Hydrolase 3 197 1.2e-8 PFAM
Pfam:HAD_2 6 203 2.5e-17 PFAM
Pfam:Hydrolase_4 256 529 6.6e-11 PFAM
Pfam:Abhydrolase_1 257 530 7.2e-38 PFAM
Pfam:Abhydrolase_5 258 524 3.5e-14 PFAM
Pfam:Abhydrolase_6 259 536 2.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224698
AA Change: D167G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000225309
AA Change: D119G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.388 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epoxide hydrolase family. The protein, found in both the cytosol and peroxisomes, binds to specific epoxides and converts them to the corresponding dihydrodiols. Mutations in this gene have been associated with familial hypercholesterolemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Males homozygous for a targeted null mutation display a significant reduction in blood pressure both in the absence and presence of dietary salt loading. Both sexes exhibit altered arachidonic acid metabolism and reduced renal formation of epoxyeicosatrienoic and dihydroxyeicosatrienoic acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,386 D347V probably damaging Het
4932431P20Rik T C 7: 29,529,955 noncoding transcript Het
A630010A05Rik T A 16: 14,609,694 F82I possibly damaging Het
Acad9 T A 3: 36,078,508 F297L possibly damaging Het
Adgrl3 A T 5: 81,512,353 Y323F probably damaging Het
Brca2 T A 5: 150,542,450 M1893K probably benign Het
Cactin A T 10: 81,322,436 probably null Het
Cadm4 A G 7: 24,503,621 *389W probably null Het
Calr4 A G 4: 109,246,241 T183A possibly damaging Het
Card10 A T 15: 78,787,841 probably benign Het
Cdh6 C A 15: 13,091,838 G14C probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cr1l A T 1: 195,131,202 L35Q probably damaging Het
Daam2 T C 17: 49,480,751 R445G possibly damaging Het
Ddn G A 15: 98,806,604 T269M probably damaging Het
Epb41 G A 4: 132,006,071 S176L probably benign Het
Erbb4 G A 1: 68,254,600 R711C probably damaging Het
Flg2 T A 3: 93,202,313 H549Q unknown Het
Gje1 A G 10: 14,716,636 probably null Het
Heatr5b G A 17: 78,753,193 H2018Y probably benign Het
Heatr5b A T 17: 78,755,427 probably benign Het
Hectd3 G T 4: 116,996,396 R189L probably benign Het
Hsd3b6 T C 3: 98,807,921 T52A probably benign Het
Il10rb T G 16: 91,421,787 probably null Het
Kcnc2 T C 10: 112,455,601 probably benign Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lrit1 T C 14: 37,061,971 F419L probably benign Het
Mmp8 T C 9: 7,567,263 C422R probably benign Het
Myo18b A G 5: 112,775,251 probably null Het
Ncor1 T A 11: 62,403,806 I280F probably damaging Het
Obox2 A C 7: 15,397,032 Q63P possibly damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr462 T A 11: 87,889,759 I46L probably benign Het
Phldb2 T A 16: 45,757,253 probably benign Het
Pkd1l1 A G 11: 8,854,386 F1735S probably damaging Het
Pramef6 G T 4: 143,896,891 L238I probably benign Het
Prss30 T C 17: 23,973,738 Y156C probably damaging Het
Rnf213 T C 11: 119,442,400 S2812P probably damaging Het
Rttn A G 18: 89,042,867 D1053G probably benign Het
Slc6a2 A G 8: 92,971,254 N120S probably damaging Het
Snrnp200 T C 2: 127,228,238 probably benign Het
Spindoc G T 19: 7,382,721 D27E probably benign Het
Svep1 T C 4: 58,115,754 T980A possibly damaging Het
Tgfbr1 A G 4: 47,393,259 E46G probably benign Het
Tmem183a T C 1: 134,361,546 I49V probably benign Het
Tmem212 C T 3: 27,885,095 V81I possibly damaging Het
Toporsl T A 4: 52,610,254 I49N probably benign Het
Trim67 A G 8: 124,823,193 T521A probably benign Het
Vsnl1 T C 12: 11,332,218 probably null Het
Xrn2 C T 2: 147,061,488 R803W probably damaging Het
Zfp131 A T 13: 119,790,248 C9S probably damaging Het
Zfp750 C T 11: 121,512,047 S625N probably damaging Het
Zfp871 G T 17: 32,774,926 T406N possibly damaging Het
Other mutations in Ephx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ephx2 APN 14 66092837 missense probably benign
IGL01143:Ephx2 APN 14 66089522 missense probably damaging 1.00
IGL02058:Ephx2 APN 14 66103724 critical splice donor site probably null
IGL02164:Ephx2 APN 14 66103720 splice site probably benign
IGL02606:Ephx2 APN 14 66086292 missense probably damaging 1.00
PIT4618001:Ephx2 UTSW 14 66102222 missense probably damaging 0.99
R0396:Ephx2 UTSW 14 66108063 missense probably benign 0.03
R0732:Ephx2 UTSW 14 66086963 critical splice donor site probably null
R0762:Ephx2 UTSW 14 66102179 missense probably damaging 1.00
R1689:Ephx2 UTSW 14 66087026 nonsense probably null
R1735:Ephx2 UTSW 14 66088303 missense probably benign
R1871:Ephx2 UTSW 14 66084734 missense probably damaging 1.00
R4210:Ephx2 UTSW 14 66084944 missense probably damaging 1.00
R5130:Ephx2 UTSW 14 66108062 missense probably damaging 0.97
R5800:Ephx2 UTSW 14 66107302 missense probably benign 0.38
R6013:Ephx2 UTSW 14 66110242 missense probably benign 0.19
R6076:Ephx2 UTSW 14 66092848 missense probably damaging 1.00
R6193:Ephx2 UTSW 14 66089512 missense probably benign 0.01
R6193:Ephx2 UTSW 14 66112220 missense probably benign 0.12
Z1088:Ephx2 UTSW 14 66107318 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGAATCATGGGTGGCAAGGAC -3'
(R):5'- CGGGAGTCACTATGCTGAAACACTG -3'

Sequencing Primer
(F):5'- TGGCAAGGACCAAGACTCTG -3'
(R):5'- GTAAAGGAAAGGTCCCTCTCCTTC -3'
Posted On2014-03-14