Incidental Mutation 'R1445:Plcb4'
ID158755
Institutional Source Beutler Lab
Gene Symbol Plcb4
Ensembl Gene ENSMUSG00000039943
Gene Namephospholipase C, beta 4
SynonymsA930039J07Rik, C230058B11Rik
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1445 (G1)
Quality Score187
Status Validated
Chromosome2
Chromosomal Location135659011-136014593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136000189 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1031 (H1031L)
Ref Sequence ENSEMBL: ENSMUSP00000105736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035646] [ENSMUST00000110109] [ENSMUST00000147744] [ENSMUST00000184371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035646
AA Change: H1031L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038409
Gene: ENSMUSG00000039943
AA Change: H1031L

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 1.1e-26 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110109
AA Change: H1031L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105736
Gene: ENSMUSG00000039943
AA Change: H1031L

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 6.1e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 913 955 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147744
AA Change: H92L

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117578
Gene: ENSMUSG00000039943
AA Change: H92L

DomainStartEndE-ValueType
Pfam:DUF1154 1 16 1.7e-7 PFAM
coiled coil region 187 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184371
SMART Domains Protein: ENSMUSP00000139274
Gene: ENSMUSG00000039943

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 9e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.1e-23 PFAM
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals in the retina. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for targeted mutations may exhibit ataxia, impaired elimination of excess climbing fiber synapses in the developing cerebellum, abnormal cerebellar foliation, reduced visual processing ability and loss of circadian rhythm in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Cep164 T G 9: 45,778,900 E675A possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Kcnq5 A C 1: 21,405,024 S473A probably benign Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mars T C 10: 127,297,988 D680G possibly damaging Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mllt6 T C 11: 97,672,451 probably benign Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Ptprz1 A G 6: 23,050,474 D1398G probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Rbl1 T C 2: 157,193,098 N354S probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tmprss4 T A 9: 45,184,385 I54F possibly damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Utrn A G 10: 12,678,574 probably benign Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Plcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Plcb4 APN 2 135971798 missense probably benign 0.26
IGL01405:Plcb4 APN 2 135950347 missense probably damaging 1.00
IGL01522:Plcb4 APN 2 136002627 missense probably damaging 1.00
IGL01589:Plcb4 APN 2 135967118 missense probably benign
IGL02090:Plcb4 APN 2 135947121 missense probably benign 0.00
IGL02247:Plcb4 APN 2 135994325 missense possibly damaging 0.95
IGL02259:Plcb4 APN 2 135910246 critical splice donor site probably null
IGL02338:Plcb4 APN 2 136000180 missense possibly damaging 0.87
IGL02625:Plcb4 APN 2 135961794 missense probably benign 0.19
IGL03026:Plcb4 APN 2 135950429 splice site probably benign
IGL03111:Plcb4 APN 2 135976282 missense probably damaging 1.00
R0044:Plcb4 UTSW 2 135971856 missense probably damaging 1.00
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0143:Plcb4 UTSW 2 135976211 missense probably damaging 1.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0348:Plcb4 UTSW 2 135968419 missense probably damaging 1.00
R0557:Plcb4 UTSW 2 135954349 missense probably damaging 0.99
R0591:Plcb4 UTSW 2 135955012 splice site probably benign
R0975:Plcb4 UTSW 2 135987912 splice site probably benign
R1187:Plcb4 UTSW 2 135968394 missense probably benign 0.36
R1235:Plcb4 UTSW 2 135972948 missense probably damaging 1.00
R1562:Plcb4 UTSW 2 135970447 critical splice donor site probably null
R1594:Plcb4 UTSW 2 135970390 splice site probably benign
R1920:Plcb4 UTSW 2 136013027 missense probably damaging 1.00
R2041:Plcb4 UTSW 2 135938271 missense probably damaging 1.00
R2141:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2142:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2202:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2203:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2204:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2250:Plcb4 UTSW 2 135971861 critical splice donor site probably null
R2291:Plcb4 UTSW 2 135939983 missense probably benign 0.08
R2326:Plcb4 UTSW 2 135939973 missense probably damaging 0.99
R2442:Plcb4 UTSW 2 135950382 missense probably damaging 1.00
R2939:Plcb4 UTSW 2 135939203 splice site probably benign
R3774:Plcb4 UTSW 2 135958145 missense probably benign 0.00
R3875:Plcb4 UTSW 2 136002632 missense probably damaging 0.99
R4594:Plcb4 UTSW 2 136002599 missense probably damaging 0.98
R4673:Plcb4 UTSW 2 135932271 missense possibly damaging 0.68
R4812:Plcb4 UTSW 2 136007881 missense probably damaging 1.00
R5084:Plcb4 UTSW 2 136002651 missense probably damaging 1.00
R5468:Plcb4 UTSW 2 135967152 missense probably damaging 1.00
R5498:Plcb4 UTSW 2 135976172 missense probably damaging 1.00
R5923:Plcb4 UTSW 2 135961814 nonsense probably null
R6241:Plcb4 UTSW 2 135910174 missense possibly damaging 0.80
R6492:Plcb4 UTSW 2 135973071 nonsense probably null
R6514:Plcb4 UTSW 2 135954996 missense probably benign 0.22
R6570:Plcb4 UTSW 2 135982986 missense probably benign 0.13
R6721:Plcb4 UTSW 2 135910237 missense probably benign 0.01
R6915:Plcb4 UTSW 2 135947115 missense possibly damaging 0.84
R6991:Plcb4 UTSW 2 135910194 missense probably damaging 1.00
R7040:Plcb4 UTSW 2 135932262 missense probably benign
R7086:Plcb4 UTSW 2 136007847 missense not run
R7114:Plcb4 UTSW 2 135982123 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- TCTCTGTTCAGACCTGTGGACTGAC -3'
(R):5'- ATAGCAGTATGGCATCTGGCCCTC -3'

Sequencing Primer
(F):5'- CTACTTAACAGCCAGAGTGGTG -3'
(R):5'- TCCCACCTGTCATGGGAGAG -3'
Posted On2014-03-14