Incidental Mutation 'R1445:Rbl1'
ID158758
Institutional Source Beutler Lab
Gene Symbol Rbl1
Ensembl Gene ENSMUSG00000027641
Gene NameRB transcriptional corepressor like 1
Synonymsp107
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1445 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157145893-157204534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 157193098 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 354 (N354S)
Ref Sequence ENSEMBL: ENSMUSP00000029170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029170]
Predicted Effect probably benign
Transcript: ENSMUST00000029170
AA Change: N354S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: N354S

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
DUF3452 70 212 5.14e-78 SMART
RB_A 385 578 9.58e-119 SMART
low complexity region 706 719 N/A INTRINSIC
CYCLIN 800 934 8.68e-6 SMART
Rb_C 947 1063 2.29e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154721
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Cep164 T G 9: 45,778,900 E675A possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Kcnq5 A C 1: 21,405,024 S473A probably benign Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mars T C 10: 127,297,988 D680G possibly damaging Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mllt6 T C 11: 97,672,451 probably benign Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plcb4 A T 2: 136,000,189 H1031L possibly damaging Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Ptprz1 A G 6: 23,050,474 D1398G probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tmprss4 T A 9: 45,184,385 I54F possibly damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Utrn A G 10: 12,678,574 probably benign Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Rbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Rbl1 APN 2 157152892 splice site probably null
IGL01418:Rbl1 APN 2 157152892 splice site probably null
IGL01597:Rbl1 APN 2 157195449 splice site probably benign
IGL01788:Rbl1 APN 2 157163656 missense probably benign 0.15
IGL02366:Rbl1 APN 2 157174893 missense probably benign 0.18
IGL02527:Rbl1 APN 2 157194048 missense probably benign 0.05
IGL02720:Rbl1 APN 2 157199429 missense possibly damaging 0.94
IGL02828:Rbl1 APN 2 157199464 missense probably damaging 1.00
IGL02926:Rbl1 APN 2 157167413 missense probably benign 0.08
IGL02968:Rbl1 APN 2 157177274 missense probably damaging 1.00
IGL03284:Rbl1 APN 2 157194069 splice site probably benign
R0042:Rbl1 UTSW 2 157175704 splice site probably benign
R0089:Rbl1 UTSW 2 157199414 critical splice donor site probably null
R0173:Rbl1 UTSW 2 157159685 missense probably benign 0.00
R0464:Rbl1 UTSW 2 157147545 missense probably damaging 1.00
R1178:Rbl1 UTSW 2 157147655 missense possibly damaging 0.92
R1296:Rbl1 UTSW 2 157169971 missense probably benign 0.09
R1430:Rbl1 UTSW 2 157169906 missense probably benign
R1511:Rbl1 UTSW 2 157195634 missense probably damaging 1.00
R1603:Rbl1 UTSW 2 157175659 missense possibly damaging 0.75
R1666:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1668:Rbl1 UTSW 2 157159734 missense probably damaging 1.00
R1680:Rbl1 UTSW 2 157174783 missense probably damaging 0.97
R1771:Rbl1 UTSW 2 157163534 splice site probably null
R1833:Rbl1 UTSW 2 157195555 missense probably damaging 0.98
R1852:Rbl1 UTSW 2 157174903 missense probably benign 0.01
R2304:Rbl1 UTSW 2 157147631 missense probably benign 0.02
R3552:Rbl1 UTSW 2 157195585 missense probably benign 0.19
R3605:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R3607:Rbl1 UTSW 2 157177233 missense probably damaging 1.00
R4160:Rbl1 UTSW 2 157192119 intron probably benign
R4423:Rbl1 UTSW 2 157168955 intron probably benign
R4636:Rbl1 UTSW 2 157167420 missense possibly damaging 0.82
R4780:Rbl1 UTSW 2 157174804 missense probably benign 0.43
R4789:Rbl1 UTSW 2 157177355 missense probably benign
R5145:Rbl1 UTSW 2 157175477 intron probably benign
R5802:Rbl1 UTSW 2 157161433 missense probably benign 0.23
R5851:Rbl1 UTSW 2 157167325 missense probably benign 0.00
R6742:Rbl1 UTSW 2 157169998 missense probably benign 0.19
R6861:Rbl1 UTSW 2 157152967 missense probably damaging 1.00
R6943:Rbl1 UTSW 2 157188286 missense probably benign
X0057:Rbl1 UTSW 2 157188329 nonsense probably null
X0058:Rbl1 UTSW 2 157174813 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTGTGTCAAGTGCAGGGACAG -3'
(R):5'- TTGCAGCAAAGCCGTGAACAAG -3'

Sequencing Primer
(F):5'- CATGACAAAACGGTGTGCTTG -3'
(R):5'- GGAATATGAAGAGTATGTCCTAACTG -3'
Posted On2014-03-14