Incidental Mutation 'R1445:Ptprz1'
ID158779
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R1445 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23050474 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1398 (D1398G)
Ref Sequence ENSEMBL: ENSMUSP00000143902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102]
Predicted Effect probably damaging
Transcript: ENSMUST00000090568
AA Change: D2247G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: D2247G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200769
Predicted Effect probably damaging
Transcript: ENSMUST00000202102
AA Change: D1398G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748
AA Change: D1398G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Cep164 T G 9: 45,778,900 E675A possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Kcnq5 A C 1: 21,405,024 S473A probably benign Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mars T C 10: 127,297,988 D680G possibly damaging Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mllt6 T C 11: 97,672,451 probably benign Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plcb4 A T 2: 136,000,189 H1031L possibly damaging Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Rbl1 T C 2: 157,193,098 N354S probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tmprss4 T A 9: 45,184,385 I54F possibly damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Utrn A G 10: 12,678,574 probably benign Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1626:Ptprz1 UTSW 6 23001574 missense probably benign
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1974:Ptprz1 UTSW 6 22986311 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2108:Ptprz1 UTSW 6 23033477 missense probably damaging 0.99
R2152:Ptprz1 UTSW 6 23030671 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4606:Ptprz1 UTSW 6 23001487 missense possibly damaging 0.80
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4803:Ptprz1 UTSW 6 23001546 missense probably benign 0.00
R4890:Ptprz1 UTSW 6 23024958 missense probably damaging 1.00
R5035:Ptprz1 UTSW 6 23016215 missense probably benign 0.06
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACACTTGGTTCTGTCCCCAATTCAATG -3'
(R):5'- CCTCAGGAATACAACTCTTCAGCTTGC -3'

Sequencing Primer
(F):5'- TCTGTCCCCAATTCAATGATAATTC -3'
(R):5'- GGTTGGTAATTCCACTCCAGG -3'
Posted On2014-03-14