Incidental Mutation 'R1445:Tmprss4'
Institutional Source Beutler Lab
Gene Symbol Tmprss4
Ensembl Gene ENSMUSG00000032091
Gene Nametransmembrane protease, serine 4
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R1445 (G1)
Quality Score225
Status Validated
Chromosomal Location45172726-45204092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45184385 bp
Amino Acid Change Isoleucine to Phenylalanine at position 54 (I54F)
Ref Sequence ENSEMBL: ENSMUSP00000131890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034599] [ENSMUST00000165263] [ENSMUST00000170069]
Predicted Effect probably benign
Transcript: ENSMUST00000034599
AA Change: I54F

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034599
Gene: ENSMUSG00000032091
AA Change: I54F

transmembrane domain 29 51 N/A INTRINSIC
LDLa 52 92 1.55e-2 SMART
SR 102 192 2.51e-7 SMART
Tryp_SPc 202 427 9.03e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164650
SMART Domains Protein: ENSMUSP00000130853
Gene: ENSMUSG00000091996

signal peptide 1 20 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165263
AA Change: I54F

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131890
Gene: ENSMUSG00000032091
AA Change: I54F

transmembrane domain 29 51 N/A INTRINSIC
LDLa 52 92 1.55e-2 SMART
SR 102 192 2.51e-7 SMART
Tryp_SPc 202 335 2.26e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171277
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine protease family. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified as a gene overexpressed in pancreatic carcinoma. The encoded protein is membrane bound with a N-terminal anchor sequence and a glycosylated extracellular region containing the serine protease domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele appear healthy and response normally to a sodium-deficient diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Cep164 T G 9: 45,778,900 E675A possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Kcnq5 A C 1: 21,405,024 S473A probably benign Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mars T C 10: 127,297,988 D680G possibly damaging Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mllt6 T C 11: 97,672,451 probably benign Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plcb4 A T 2: 136,000,189 H1031L possibly damaging Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Ptprz1 A G 6: 23,050,474 D1398G probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Rbl1 T C 2: 157,193,098 N354S probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Utrn A G 10: 12,678,574 probably benign Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Tmprss4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Tmprss4 APN 9 45179420 missense probably damaging 1.00
R0153:Tmprss4 UTSW 9 45184336 missense probably benign 0.01
R2359:Tmprss4 UTSW 9 45185832 missense probably benign
R3918:Tmprss4 UTSW 9 45180666 missense probably benign 0.13
R3919:Tmprss4 UTSW 9 45180666 missense probably benign 0.13
R4655:Tmprss4 UTSW 9 45176404 missense probably benign
R4949:Tmprss4 UTSW 9 45175543 missense possibly damaging 0.92
R4976:Tmprss4 UTSW 9 45173408 missense possibly damaging 0.86
R5177:Tmprss4 UTSW 9 45173962 missense probably benign 0.09
R5918:Tmprss4 UTSW 9 45175116 nonsense probably null
R6922:Tmprss4 UTSW 9 45185922 missense probably benign
R7091:Tmprss4 UTSW 9 45184273 missense not run
X0058:Tmprss4 UTSW 9 45177833 missense probably damaging 1.00
Z1088:Tmprss4 UTSW 9 45175465 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cccaaaagttgtcctctgacc -3'
Posted On2014-03-14