Incidental Mutation 'R1445:Cep164'
ID158795
Institutional Source Beutler Lab
Gene Symbol Cep164
Ensembl Gene ENSMUSG00000043987
Gene Namecentrosomal protein 164
Synonyms
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R1445 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45766946-45828691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45778900 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 675 (E675A)
Ref Sequence ENSEMBL: ENSMUSP00000114053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117194] [ENSMUST00000213154] [ENSMUST00000216284] [ENSMUST00000217554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117194
AA Change: E675A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114053
Gene: ENSMUSG00000043987
AA Change: E675A

DomainStartEndE-ValueType
WW 57 89 1.99e-3 SMART
low complexity region 110 127 N/A INTRINSIC
low complexity region 189 201 N/A INTRINSIC
low complexity region 210 229 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
coiled coil region 511 735 N/A INTRINSIC
low complexity region 741 756 N/A INTRINSIC
coiled coil region 761 931 N/A INTRINSIC
low complexity region 956 962 N/A INTRINSIC
coiled coil region 1057 1084 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
low complexity region 1141 1168 N/A INTRINSIC
low complexity region 1185 1195 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132430
AA Change: E552A
SMART Domains Protein: ENSMUSP00000117344
Gene: ENSMUSG00000043987
AA Change: E552A

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
coiled coil region 325 612 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213154
AA Change: E1376A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216284
AA Change: E515A

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217554
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein involved in microtubule organization, DNA damage response, and chromosome segregation. The encoded protein is required for assembly of primary cilia and localizes to mature centrioles. Defects in this gene are a cause of nephronophthisis-related ciliopathies. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Kcnq5 A C 1: 21,405,024 S473A probably benign Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mars T C 10: 127,297,988 D680G possibly damaging Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mllt6 T C 11: 97,672,451 probably benign Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plcb4 A T 2: 136,000,189 H1031L possibly damaging Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Ptprz1 A G 6: 23,050,474 D1398G probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Rbl1 T C 2: 157,193,098 N354S probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tmprss4 T A 9: 45,184,385 I54F possibly damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Utrn A G 10: 12,678,574 probably benign Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Cep164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Cep164 APN 9 45775256 missense possibly damaging 0.46
IGL01571:Cep164 APN 9 45794338 missense possibly damaging 0.82
IGL01985:Cep164 APN 9 45779606 missense probably damaging 1.00
IGL01989:Cep164 APN 9 45793015 splice site probably benign
IGL02130:Cep164 APN 9 45779792 missense possibly damaging 0.82
IGL02598:Cep164 APN 9 45770704 missense probably damaging 1.00
IGL03206:Cep164 APN 9 45802725 missense probably benign 0.00
R0063:Cep164 UTSW 9 45768618 missense possibly damaging 0.83
R0109:Cep164 UTSW 9 45771587 missense probably damaging 1.00
R0528:Cep164 UTSW 9 45776936 unclassified probably benign
R0532:Cep164 UTSW 9 45809826 nonsense probably null
R1753:Cep164 UTSW 9 45792937 missense probably damaging 0.99
R1824:Cep164 UTSW 9 45778928 missense probably damaging 1.00
R1856:Cep164 UTSW 9 45775758 splice site probably null
R1858:Cep164 UTSW 9 45823640 splice site probably benign
R1900:Cep164 UTSW 9 45809825 missense probably damaging 1.00
R1911:Cep164 UTSW 9 45770806 missense probably benign 0.09
R2032:Cep164 UTSW 9 45771600 missense probably damaging 1.00
R2133:Cep164 UTSW 9 45803183 missense probably damaging 1.00
R2186:Cep164 UTSW 9 45768578 missense probably damaging 1.00
R2511:Cep164 UTSW 9 45775249 missense probably damaging 1.00
R4424:Cep164 UTSW 9 45779704 missense possibly damaging 0.92
R5126:Cep164 UTSW 9 45787424 critical splice donor site probably null
R5997:Cep164 UTSW 9 45769463 missense possibly damaging 0.92
R6186:Cep164 UTSW 9 45794109 missense probably damaging 0.98
R6357:Cep164 UTSW 9 45770884 missense probably damaging 1.00
R6385:Cep164 UTSW 9 45779783 missense probably damaging 0.99
R6632:Cep164 UTSW 9 45779790 missense possibly damaging 0.66
R6957:Cep164 UTSW 9 45772280 critical splice donor site probably null
X0024:Cep164 UTSW 9 45775863 critical splice donor site probably null
X0028:Cep164 UTSW 9 45770967 missense probably damaging 1.00
X0065:Cep164 UTSW 9 45774787 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATCTTACACATGAAGTGTCCCCAACC -3'
(R):5'- TCTGTTCCTCACTGGAAGCCAAAC -3'

Sequencing Primer
(F):5'- GTACATGTCTGAACTATTACCACC -3'
(R):5'- TGGCCCCTTCATGCTGG -3'
Posted On2014-03-14