Incidental Mutation 'R1445:Mllt6'
ID158809
Institutional Source Beutler Lab
Gene Symbol Mllt6
Ensembl Gene ENSMUSG00000038437
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
SynonymsAf17
MMRRC Submission 039500-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1445 (G1)
Quality Score169
Status Validated
Chromosome11
Chromosomal Location97663414-97685463 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 97672451 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044730] [ENSMUST00000107586]
Predicted Effect probably benign
Transcript: ENSMUST00000044730
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107586
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184494
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.9%
  • 20x: 84.0%
Validation Efficiency 96% (101/105)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061I17Rik G T 3: 117,067,736 noncoding transcript Het
2300003K06Rik G T 11: 99,837,967 Q17K probably benign Het
Abca16 T C 7: 120,520,033 V999A probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Agap2 T A 10: 127,091,112 probably benign Het
Ago3 C A 4: 126,371,787 R278L probably benign Het
Aldh1a2 T C 9: 71,285,210 V449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplnr A G 2: 85,137,009 Y126C probably damaging Het
Apob T C 12: 8,016,084 I4351T possibly damaging Het
Ash1l T C 3: 89,007,352 L1763P probably benign Het
Aspn T C 13: 49,557,373 S165P possibly damaging Het
Atg13 A T 2: 91,679,990 V349E probably damaging Het
Atp1b2 T A 11: 69,602,483 probably null Het
B3glct A T 5: 149,754,139 D411V probably damaging Het
Bcar3 A T 3: 122,523,191 I255F probably damaging Het
Cacna1b G A 2: 24,718,136 probably benign Het
Cep164 T G 9: 45,778,900 E675A possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chst8 C A 7: 34,748,168 M8I possibly damaging Het
Clec4n A G 6: 123,235,516 E67G probably benign Het
Cobll1 A T 2: 65,099,136 D653E probably damaging Het
Col9a1 T C 1: 24,237,498 probably null Het
Crip2 T C 12: 113,143,504 L30P probably damaging Het
Ctbp1 C T 5: 33,261,063 V22I probably benign Het
Cwc22 T C 2: 77,917,177 probably benign Het
Cyp4a32 C A 4: 115,602,950 Y119* probably null Het
Dido1 G T 2: 180,671,470 A463E possibly damaging Het
Dnah7a G A 1: 53,528,797 P1880L probably benign Het
Dock2 T A 11: 34,239,705 T1489S probably benign Het
Dsp A G 13: 38,191,931 T1231A probably damaging Het
Eif2ak1 G T 5: 143,873,899 probably benign Het
Epc1 A T 18: 6,452,360 M233K probably damaging Het
Fam189a2 G A 19: 24,021,634 T140M probably damaging Het
Gigyf2 A G 1: 87,443,638 probably benign Het
Greb1 T G 12: 16,707,851 H58P probably damaging Het
Gtpbp1 T C 15: 79,713,448 I348T possibly damaging Het
Hck A T 2: 153,128,272 N64Y probably benign Het
Herc2 T C 7: 56,168,996 S2812P probably damaging Het
Inpp4b T A 8: 81,952,834 probably null Het
Kcnq5 A C 1: 21,405,024 S473A probably benign Het
Lrat T G 3: 82,903,369 D115A probably damaging Het
Lyst A G 13: 13,640,054 I1131M possibly damaging Het
Man2a2 T C 7: 80,368,562 D160G probably benign Het
Marf1 C T 16: 14,115,824 D1567N probably benign Het
Mars T C 10: 127,297,988 D680G possibly damaging Het
Mat1a T C 14: 41,121,840 S339P probably damaging Het
Megf8 T C 7: 25,342,656 S1300P probably damaging Het
Mga T C 2: 119,902,698 L9S probably damaging Het
Mrpl37 A G 4: 107,064,495 L179P probably benign Het
Mtnr1a G T 8: 45,087,745 V248L probably benign Het
Mylk T C 16: 34,815,465 S19P possibly damaging Het
Olfr738 A G 14: 50,414,401 T286A probably damaging Het
Parp8 A T 13: 117,025,350 probably null Het
Pcnx2 T C 8: 125,752,284 D2075G probably damaging Het
Pigo A T 4: 43,021,460 I494K probably benign Het
Pkd1l1 A T 11: 8,870,313 D1217E probably benign Het
Pkhd1l1 T C 15: 44,505,644 V895A probably benign Het
Plcb4 A T 2: 136,000,189 H1031L possibly damaging Het
Plxnb1 A G 9: 109,108,921 K1245R probably null Het
Pold1 C T 7: 44,542,757 probably benign Het
Ptprq T C 10: 107,662,562 I885V probably damaging Het
Ptprz1 A G 6: 23,050,474 D1398G probably damaging Het
Pygm G A 19: 6,389,887 A364T probably benign Het
Rbl1 T C 2: 157,193,098 N354S probably benign Het
Scgb2b19 C T 7: 33,279,612 probably null Het
Slc26a8 C T 17: 28,648,213 V545M possibly damaging Het
Slc27a1 T A 8: 71,584,113 probably null Het
Smpd1 A G 7: 105,556,674 D416G possibly damaging Het
Sorbs3 A G 14: 70,193,646 V284A probably benign Het
Stfa2l1 T C 16: 36,161,784 V75A probably damaging Het
Syndig1 A G 2: 149,930,921 D166G probably damaging Het
Tcp10a G A 17: 7,326,007 probably null Het
Themis2 T A 4: 132,782,901 I663F possibly damaging Het
Thrap3 T C 4: 126,176,336 Q586R probably damaging Het
Tinag C A 9: 77,045,516 C62F probably damaging Het
Tmem206 A G 1: 191,348,362 probably benign Het
Tmod1 T C 4: 46,090,884 Y146H probably damaging Het
Tmprss4 T A 9: 45,184,385 I54F possibly damaging Het
Tnks A C 8: 34,834,603 probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Trpc6 A G 9: 8,680,537 E844G probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Ubxn6 T C 17: 56,069,042 D373G probably benign Het
Upf1 T A 8: 70,341,524 Q244L probably benign Het
Usp33 A G 3: 152,368,634 I372M probably damaging Het
Usp34 A G 11: 23,351,629 E351G probably damaging Het
Utrn A G 10: 12,678,574 probably benign Het
Vmn1r78 A G 7: 12,152,581 K40E possibly damaging Het
Vmn2r7 T A 3: 64,724,802 M80L probably benign Het
Vps13a G T 19: 16,701,238 Y1126* probably null Het
Wfdc11 T C 2: 164,664,446 N60S probably benign Het
Wnk2 C T 13: 49,071,110 D992N probably damaging Het
Zpbp2 C A 11: 98,553,844 T66K probably damaging Het
Other mutations in Mllt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Mllt6 APN 11 97676928 missense probably damaging 1.00
IGL01808:Mllt6 APN 11 97672484 missense possibly damaging 0.88
IGL01967:Mllt6 APN 11 97674777 missense probably damaging 0.98
IGL02247:Mllt6 APN 11 97670332 missense probably benign 0.01
IGL03161:Mllt6 APN 11 97667151 missense probably benign 0.03
R0284:Mllt6 UTSW 11 97678605 missense probably benign 0.02
R0718:Mllt6 UTSW 11 97676359 splice site probably benign
R0783:Mllt6 UTSW 11 97665745 missense probably damaging 0.99
R0811:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0812:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0904:Mllt6 UTSW 11 97664998 missense probably damaging 1.00
R0960:Mllt6 UTSW 11 97664946 splice site probably benign
R1523:Mllt6 UTSW 11 97665023 missense probably damaging 1.00
R1781:Mllt6 UTSW 11 97672569 missense probably benign
R1952:Mllt6 UTSW 11 97677222 missense probably damaging 0.99
R2258:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2259:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2927:Mllt6 UTSW 11 97680776 missense probably damaging 0.98
R4866:Mllt6 UTSW 11 97674459 missense probably damaging 1.00
R4938:Mllt6 UTSW 11 97678407 missense probably benign
R5039:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5058:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5064:Mllt6 UTSW 11 97673949 missense probably damaging 1.00
R5076:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5115:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5379:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5509:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5510:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5511:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5603:Mllt6 UTSW 11 97673505 missense probably damaging 1.00
R5816:Mllt6 UTSW 11 97672574 missense probably damaging 0.97
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6051:Mllt6 UTSW 11 97680743 nonsense probably null
R6180:Mllt6 UTSW 11 97678536 missense possibly damaging 0.85
R6277:Mllt6 UTSW 11 97673948 missense probably damaging 1.00
R6667:Mllt6 UTSW 11 97676934 missense probably damaging 1.00
R6754:Mllt6 UTSW 11 97674447 missense probably damaging 1.00
R6791:Mllt6 UTSW 11 97680602 missense probably damaging 0.98
R7049:Mllt6 UTSW 11 97673811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTGACTACGGATGCCTCGGAC -3'
(R):5'- TGAAACTGCTCACACCTTTCCCAG -3'

Sequencing Primer
(F):5'- CTGTTGGGTCATGGGACAAAC -3'
(R):5'- ACCTTTCCCAGTGCCCAG -3'
Posted On2014-03-14