Incidental Mutation 'R1446:Pde6d'
ID158837
Institutional Source Beutler Lab
Gene Symbol Pde6d
Ensembl Gene ENSMUSG00000026239
Gene Namephosphodiesterase 6D, cGMP-specific, rod, delta
Synonyms
MMRRC Submission 039501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R1446 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location86542994-86582629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86546692 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 77 (E77G)
Ref Sequence ENSEMBL: ENSMUSP00000027444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027444] [ENSMUST00000143674] [ENSMUST00000146220]
Predicted Effect probably damaging
Transcript: ENSMUST00000027444
AA Change: E77G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027444
Gene: ENSMUSG00000026239
AA Change: E77G

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 9 149 1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143674
SMART Domains Protein: ENSMUSP00000137956
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 64 4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146220
AA Change: E77G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137820
Gene: ENSMUSG00000026239
AA Change: E77G

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 124 6.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150653
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit progressive retinal degeneration with progressive loss of rod and cone neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,289 A472T probably benign Het
Adcy4 A T 14: 55,770,023 probably null Het
Ahcyl2 T C 6: 29,891,240 S448P probably damaging Het
Anks1b A G 10: 90,511,073 Y745C probably benign Het
Anxa1 A T 19: 20,373,739 L339Q probably damaging Het
Apoa4 A G 9: 46,242,293 D64G probably benign Het
Arpc1a A G 5: 145,101,086 probably null Het
Bank1 C T 3: 136,064,143 G727R probably damaging Het
Best2 T C 8: 85,007,964 Q375R probably benign Het
Cacna1b T A 2: 24,706,177 M501L probably benign Het
Col27a1 T A 4: 63,224,803 Y243N probably damaging Het
Cyp11a1 A T 9: 58,015,277 Q80L possibly damaging Het
Dnah10 T A 5: 124,789,796 W2260R probably damaging Het
Dnajc19 T C 3: 34,057,979 H139R probably benign Het
Dppa5a T A 9: 78,367,789 N77I probably benign Het
Edc4 T C 8: 105,888,132 S125P probably damaging Het
Eid2 T C 7: 28,268,589 I212T possibly damaging Het
Fam234b T A 6: 135,209,330 probably null Het
Frem2 T C 3: 53,654,596 E830G probably benign Het
Fyb A T 15: 6,652,466 I765L probably benign Het
Fyn T G 10: 39,522,779 S124A probably benign Het
Gal3st3 T A 19: 5,306,911 F105I probably damaging Het
Gm13762 A G 2: 88,973,765 I42T probably benign Het
Gpr146 A G 5: 139,393,422 I326M probably benign Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Gsn A G 2: 35,306,586 K669R probably benign Het
H2-T10 A T 17: 36,119,374 I225N possibly damaging Het
Il12rb2 T C 6: 67,309,143 H106R probably benign Het
Kat14 A G 2: 144,373,718 E41G probably damaging Het
Kcnma1 G T 14: 23,311,724 T1006K probably damaging Het
Kif18b G A 11: 102,914,699 T244I probably damaging Het
Klb A T 5: 65,348,995 H195L probably damaging Het
Lrriq4 T C 3: 30,650,578 F252L probably benign Het
Lum C T 10: 97,568,390 T49I possibly damaging Het
Map3k4 T A 17: 12,256,794 L84* probably null Het
Mindy2 A G 9: 70,607,456 probably null Het
Mpped2 G T 2: 106,783,732 R137L possibly damaging Het
Myo18b G A 5: 112,757,559 R2058W probably damaging Het
Nol8 T A 13: 49,655,227 L65Q probably damaging Het
Olfr1009 A G 2: 85,721,573 H56R probably damaging Het
Olfr1269 A T 2: 90,118,858 L247M probably damaging Het
Olfr1458 G A 19: 13,103,016 A96V possibly damaging Het
Olfr147 T G 9: 38,403,305 C144G possibly damaging Het
Olfr460 C T 6: 40,571,899 S171L probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Parp12 G T 6: 39,102,561 D338E probably benign Het
Phkg1 A C 5: 129,873,214 probably null Het
Pigw A C 11: 84,878,360 S48A probably benign Het
Pkm T A 9: 59,668,910 probably null Het
Ppp1r3f G A X: 7,560,363 T553M probably damaging Het
Retreg2 T A 1: 75,143,459 F44L possibly damaging Het
Ryr2 A T 13: 11,738,149 M1762K probably benign Het
Sec16a A G 2: 26,423,567 V1927A probably benign Het
Sec23a G T 12: 58,978,559 A492E probably damaging Het
Skint4 T A 4: 112,118,114 H82Q probably benign Het
Srbd1 T C 17: 86,139,152 K60E probably benign Het
Stk24 A G 14: 121,308,044 Y101H probably damaging Het
Sult1e1 A T 5: 87,578,537 N239K probably damaging Het
Tgs1 C T 4: 3,604,848 P757S probably damaging Het
Tmc2 A T 2: 130,248,730 E665D probably damaging Het
Tmprss15 C A 16: 79,078,958 D163Y probably benign Het
Unc13a C A 8: 71,648,981 V1009L possibly damaging Het
Unc45b G T 11: 82,928,670 G490C probably damaging Het
Vmn1r177 T A 7: 23,866,340 H37L probably damaging Het
Vwa5a A G 9: 38,733,968 M450V possibly damaging Het
Wars2 T C 3: 99,187,527 I46T probably benign Het
Wdfy3 G T 5: 101,851,310 T3098K possibly damaging Het
Zan A T 5: 137,389,360 I4863N unknown Het
Zfp616 A G 11: 74,083,238 probably null Het
Zfp770 A T 2: 114,197,033 I185N probably damaging Het
Zfp808 T G 13: 62,173,007 H683Q probably damaging Het
Zmym4 A T 4: 126,882,482 W1221R probably damaging Het
Other mutations in Pde6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
costume UTSW 1 86547526 splice site probably null
R0879:Pde6d UTSW 1 86545801 missense probably benign 0.04
R2018:Pde6d UTSW 1 86546716 missense probably damaging 1.00
R2118:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2119:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2120:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2122:Pde6d UTSW 1 86545802 missense probably benign 0.10
R3084:Pde6d UTSW 1 86547526 splice site probably null
R3085:Pde6d UTSW 1 86547526 splice site probably null
R6824:Pde6d UTSW 1 86545763 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TCAAAGCCCACTTTACTTGGTGTCC -3'
(R):5'- TGTTCCTTGACGACGAGTCTCCTG -3'

Sequencing Primer
(F):5'- ACTTTACTTGGTGTCCAGTCTTG -3'
(R):5'- GCTGGAACATAATGCAGTTACC -3'
Posted On2014-03-14