Incidental Mutation 'R1446:Phkg1'
ID158864
Institutional Source Beutler Lab
Gene Symbol Phkg1
Ensembl Gene ENSMUSG00000025537
Gene Namephosphorylase kinase gamma 1
Synonyms
MMRRC Submission 039501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1446 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129863421-129898549 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 129873214 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026617] [ENSMUST00000140667] [ENSMUST00000154932]
Predicted Effect probably null
Transcript: ENSMUST00000026617
SMART Domains Protein: ENSMUSP00000026617
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
S_TKc 20 288 3.79e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154495
Predicted Effect probably null
Transcript: ENSMUST00000154932
SMART Domains Protein: ENSMUSP00000122040
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 95 3.6e-13 PFAM
Pfam:Pkinase 1 100 7.3e-32 PFAM
Pfam:Kdo 3 77 8.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200832
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201268
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ser/Thr protein kinase family and encodes a protein with one protein kinase domain and two calmodulin-binding domains. This protein is the catalytic member of a 16 subunit protein kinase complex which contains equimolar ratios of 4 subunit types. The complex is a crucial glycogenolytic regulatory enzyme. This gene has two pseudogenes at chromosome 7q11.21 and one at chromosome 11p11.12. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,289 A472T probably benign Het
Adcy4 A T 14: 55,770,023 probably null Het
Ahcyl2 T C 6: 29,891,240 S448P probably damaging Het
Anks1b A G 10: 90,511,073 Y745C probably benign Het
Anxa1 A T 19: 20,373,739 L339Q probably damaging Het
Apoa4 A G 9: 46,242,293 D64G probably benign Het
Arpc1a A G 5: 145,101,086 probably null Het
Bank1 C T 3: 136,064,143 G727R probably damaging Het
Best2 T C 8: 85,007,964 Q375R probably benign Het
Cacna1b T A 2: 24,706,177 M501L probably benign Het
Col27a1 T A 4: 63,224,803 Y243N probably damaging Het
Cyp11a1 A T 9: 58,015,277 Q80L possibly damaging Het
Dnah10 T A 5: 124,789,796 W2260R probably damaging Het
Dnajc19 T C 3: 34,057,979 H139R probably benign Het
Dppa5a T A 9: 78,367,789 N77I probably benign Het
Edc4 T C 8: 105,888,132 S125P probably damaging Het
Eid2 T C 7: 28,268,589 I212T possibly damaging Het
Fam234b T A 6: 135,209,330 probably null Het
Frem2 T C 3: 53,654,596 E830G probably benign Het
Fyb A T 15: 6,652,466 I765L probably benign Het
Fyn T G 10: 39,522,779 S124A probably benign Het
Gal3st3 T A 19: 5,306,911 F105I probably damaging Het
Gm13762 A G 2: 88,973,765 I42T probably benign Het
Gpr146 A G 5: 139,393,422 I326M probably benign Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Gsn A G 2: 35,306,586 K669R probably benign Het
H2-T10 A T 17: 36,119,374 I225N possibly damaging Het
Il12rb2 T C 6: 67,309,143 H106R probably benign Het
Kat14 A G 2: 144,373,718 E41G probably damaging Het
Kcnma1 G T 14: 23,311,724 T1006K probably damaging Het
Kif18b G A 11: 102,914,699 T244I probably damaging Het
Klb A T 5: 65,348,995 H195L probably damaging Het
Lrriq4 T C 3: 30,650,578 F252L probably benign Het
Lum C T 10: 97,568,390 T49I possibly damaging Het
Map3k4 T A 17: 12,256,794 L84* probably null Het
Mindy2 A G 9: 70,607,456 probably null Het
Mpped2 G T 2: 106,783,732 R137L possibly damaging Het
Myo18b G A 5: 112,757,559 R2058W probably damaging Het
Nol8 T A 13: 49,655,227 L65Q probably damaging Het
Olfr1009 A G 2: 85,721,573 H56R probably damaging Het
Olfr1269 A T 2: 90,118,858 L247M probably damaging Het
Olfr1458 G A 19: 13,103,016 A96V possibly damaging Het
Olfr147 T G 9: 38,403,305 C144G possibly damaging Het
Olfr460 C T 6: 40,571,899 S171L probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Parp12 G T 6: 39,102,561 D338E probably benign Het
Pde6d T C 1: 86,546,692 E77G probably damaging Het
Pigw A C 11: 84,878,360 S48A probably benign Het
Pkm T A 9: 59,668,910 probably null Het
Ppp1r3f G A X: 7,560,363 T553M probably damaging Het
Retreg2 T A 1: 75,143,459 F44L possibly damaging Het
Ryr2 A T 13: 11,738,149 M1762K probably benign Het
Sec16a A G 2: 26,423,567 V1927A probably benign Het
Sec23a G T 12: 58,978,559 A492E probably damaging Het
Skint4 T A 4: 112,118,114 H82Q probably benign Het
Srbd1 T C 17: 86,139,152 K60E probably benign Het
Stk24 A G 14: 121,308,044 Y101H probably damaging Het
Sult1e1 A T 5: 87,578,537 N239K probably damaging Het
Tgs1 C T 4: 3,604,848 P757S probably damaging Het
Tmc2 A T 2: 130,248,730 E665D probably damaging Het
Tmprss15 C A 16: 79,078,958 D163Y probably benign Het
Unc13a C A 8: 71,648,981 V1009L possibly damaging Het
Unc45b G T 11: 82,928,670 G490C probably damaging Het
Vmn1r177 T A 7: 23,866,340 H37L probably damaging Het
Vwa5a A G 9: 38,733,968 M450V possibly damaging Het
Wars2 T C 3: 99,187,527 I46T probably benign Het
Wdfy3 G T 5: 101,851,310 T3098K possibly damaging Het
Zan A T 5: 137,389,360 I4863N unknown Het
Zfp616 A G 11: 74,083,238 probably null Het
Zfp770 A T 2: 114,197,033 I185N probably damaging Het
Zfp808 T G 13: 62,173,007 H683Q probably damaging Het
Zmym4 A T 4: 126,882,482 W1221R probably damaging Het
Other mutations in Phkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Phkg1 APN 5 129865073 nonsense probably null
IGL01116:Phkg1 APN 5 129864972 splice site probably null
IGL01713:Phkg1 APN 5 129866873 missense probably benign 0.01
IGL02246:Phkg1 APN 5 129864638 missense probably damaging 0.97
IGL02803:Phkg1 APN 5 129866054 missense possibly damaging 0.95
IGL02954:Phkg1 APN 5 129866069 missense probably damaging 1.00
PIT4403001:Phkg1 UTSW 5 129865931 missense probably benign 0.02
R0041:Phkg1 UTSW 5 129874262 missense probably benign
R0140:Phkg1 UTSW 5 129864608 missense probably benign 0.01
R0321:Phkg1 UTSW 5 129869524 start codon destroyed probably null 1.00
R0646:Phkg1 UTSW 5 129864553 unclassified probably null
R1142:Phkg1 UTSW 5 129873232 missense possibly damaging 0.92
R2350:Phkg1 UTSW 5 129864532 missense probably damaging 1.00
R2896:Phkg1 UTSW 5 129864630 missense possibly damaging 0.46
R4773:Phkg1 UTSW 5 129873273 splice site probably null
R7236:Phkg1 UTSW 5 129866961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCAAACCTGGCAGTGTGGC -3'
(R):5'- TTCAAGGGCATCTTGCTCAGTGGC -3'

Sequencing Primer
(F):5'- AGTGTGGCCCTGAATCAACTG -3'
(R):5'- CCAATTACTGAGGCTCTAGGTGC -3'
Posted On2014-03-14