Incidental Mutation 'R1446:Grk2'
ID158913
Institutional Source Beutler Lab
Gene Symbol Grk2
Ensembl Gene ENSMUSG00000024858
Gene NameG protein-coupled receptor kinase 2
SynonymsAdrbk-1, beta-adrenergic receptor kinase-1, beta-AR kinase-1, Bark-1, beta ARK, beta ARK1, betaARK1, Adrbk1
MMRRC Submission 039501-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1446 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4286001-4306222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4287409 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 617 (R617C)
Ref Sequence ENSEMBL: ENSMUSP00000086114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025791] [ENSMUST00000056888] [ENSMUST00000088737] [ENSMUST00000113837] [ENSMUST00000163858] [ENSMUST00000167215] [ENSMUST00000171123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025791
AA Change: R575C

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025791
Gene: ENSMUSG00000024858
AA Change: R575C

DomainStartEndE-ValueType
RGS 12 133 3.17e-30 SMART
S_TKc 149 411 2.43e-86 SMART
S_TK_X 412 491 5.3e-9 SMART
PH 517 612 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056888
SMART Domains Protein: ENSMUSP00000053783
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Pfam:GPCR_chapero_1 155 469 1.2e-111 PFAM
UIM 482 501 3.2e-2 SMART
UIM 528 547 1.92e2 SMART
UIM 564 583 8.18e0 SMART
UIM 589 605 6e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088737
AA Change: R617C

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086114
Gene: ENSMUSG00000024858
AA Change: R617C

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
S_TKc 191 453 2.43e-86 SMART
S_TK_X 454 533 5.3e-9 SMART
PH 559 654 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113837
SMART Domains Protein: ENSMUSP00000109468
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163858
SMART Domains Protein: ENSMUSP00000128932
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164427
Predicted Effect probably benign
Transcript: ENSMUST00000165954
SMART Domains Protein: ENSMUSP00000128177
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Pfam:Pkinase 1 169 5.8e-46 PFAM
Pfam:Pkinase_Tyr 2 155 9.3e-20 PFAM
S_TK_X 170 208 3.39e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167172
Predicted Effect probably benign
Transcript: ENSMUST00000167215
SMART Domains Protein: ENSMUSP00000128037
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168594
SMART Domains Protein: ENSMUSP00000126025
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
Blast:S_TKc 2 38 2e-18 BLAST
S_TK_X 39 85 2.95e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169991
Predicted Effect probably benign
Transcript: ENSMUST00000171123
SMART Domains Protein: ENSMUSP00000126930
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Pfam:Pkinase_Tyr 191 378 1.1e-21 PFAM
Pfam:Pkinase 191 381 4.9e-50 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene phosphorylates the beta-2-adrenergic receptor and appears to mediate agonist-specific desensitization observed at high agonist concentrations. This protein is an ubiquitous cytosolic enzyme that specifically phosphorylates the activated form of the beta-adrenergic and related G-protein-coupled receptors. Abnormal coupling of beta-adrenergic receptor to G protein is involved in the pathogenesis of the failing heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality likely due to heart failure. Homozygous mutant embryos are pale in appearance and exhibit ventricular hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C T 5: 76,886,289 A472T probably benign Het
Adcy4 A T 14: 55,770,023 probably null Het
Ahcyl2 T C 6: 29,891,240 S448P probably damaging Het
Anks1b A G 10: 90,511,073 Y745C probably benign Het
Anxa1 A T 19: 20,373,739 L339Q probably damaging Het
Apoa4 A G 9: 46,242,293 D64G probably benign Het
Arpc1a A G 5: 145,101,086 probably null Het
Bank1 C T 3: 136,064,143 G727R probably damaging Het
Best2 T C 8: 85,007,964 Q375R probably benign Het
Cacna1b T A 2: 24,706,177 M501L probably benign Het
Col27a1 T A 4: 63,224,803 Y243N probably damaging Het
Cyp11a1 A T 9: 58,015,277 Q80L possibly damaging Het
Dnah10 T A 5: 124,789,796 W2260R probably damaging Het
Dnajc19 T C 3: 34,057,979 H139R probably benign Het
Dppa5a T A 9: 78,367,789 N77I probably benign Het
Edc4 T C 8: 105,888,132 S125P probably damaging Het
Eid2 T C 7: 28,268,589 I212T possibly damaging Het
Fam234b T A 6: 135,209,330 probably null Het
Frem2 T C 3: 53,654,596 E830G probably benign Het
Fyb A T 15: 6,652,466 I765L probably benign Het
Fyn T G 10: 39,522,779 S124A probably benign Het
Gal3st3 T A 19: 5,306,911 F105I probably damaging Het
Gm13762 A G 2: 88,973,765 I42T probably benign Het
Gpr146 A G 5: 139,393,422 I326M probably benign Het
Gsn A G 2: 35,306,586 K669R probably benign Het
H2-T10 A T 17: 36,119,374 I225N possibly damaging Het
Il12rb2 T C 6: 67,309,143 H106R probably benign Het
Kat14 A G 2: 144,373,718 E41G probably damaging Het
Kcnma1 G T 14: 23,311,724 T1006K probably damaging Het
Kif18b G A 11: 102,914,699 T244I probably damaging Het
Klb A T 5: 65,348,995 H195L probably damaging Het
Lrriq4 T C 3: 30,650,578 F252L probably benign Het
Lum C T 10: 97,568,390 T49I possibly damaging Het
Map3k4 T A 17: 12,256,794 L84* probably null Het
Mindy2 A G 9: 70,607,456 probably null Het
Mpped2 G T 2: 106,783,732 R137L possibly damaging Het
Myo18b G A 5: 112,757,559 R2058W probably damaging Het
Nol8 T A 13: 49,655,227 L65Q probably damaging Het
Olfr1009 A G 2: 85,721,573 H56R probably damaging Het
Olfr1269 A T 2: 90,118,858 L247M probably damaging Het
Olfr1458 G A 19: 13,103,016 A96V possibly damaging Het
Olfr147 T G 9: 38,403,305 C144G possibly damaging Het
Olfr460 C T 6: 40,571,899 S171L probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Parp12 G T 6: 39,102,561 D338E probably benign Het
Pde6d T C 1: 86,546,692 E77G probably damaging Het
Phkg1 A C 5: 129,873,214 probably null Het
Pigw A C 11: 84,878,360 S48A probably benign Het
Pkm T A 9: 59,668,910 probably null Het
Ppp1r3f G A X: 7,560,363 T553M probably damaging Het
Retreg2 T A 1: 75,143,459 F44L possibly damaging Het
Ryr2 A T 13: 11,738,149 M1762K probably benign Het
Sec16a A G 2: 26,423,567 V1927A probably benign Het
Sec23a G T 12: 58,978,559 A492E probably damaging Het
Skint4 T A 4: 112,118,114 H82Q probably benign Het
Srbd1 T C 17: 86,139,152 K60E probably benign Het
Stk24 A G 14: 121,308,044 Y101H probably damaging Het
Sult1e1 A T 5: 87,578,537 N239K probably damaging Het
Tgs1 C T 4: 3,604,848 P757S probably damaging Het
Tmc2 A T 2: 130,248,730 E665D probably damaging Het
Tmprss15 C A 16: 79,078,958 D163Y probably benign Het
Unc13a C A 8: 71,648,981 V1009L possibly damaging Het
Unc45b G T 11: 82,928,670 G490C probably damaging Het
Vmn1r177 T A 7: 23,866,340 H37L probably damaging Het
Vwa5a A G 9: 38,733,968 M450V possibly damaging Het
Wars2 T C 3: 99,187,527 I46T probably benign Het
Wdfy3 G T 5: 101,851,310 T3098K possibly damaging Het
Zan A T 5: 137,389,360 I4863N unknown Het
Zfp616 A G 11: 74,083,238 probably null Het
Zfp770 A T 2: 114,197,033 I185N probably damaging Het
Zfp808 T G 13: 62,173,007 H683Q probably damaging Het
Zmym4 A T 4: 126,882,482 W1221R probably damaging Het
Other mutations in Grk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Grk2 APN 19 4289311 critical splice donor site probably null
IGL00927:Grk2 APN 19 4287954 missense probably benign 0.09
IGL01465:Grk2 APN 19 4290858 missense probably damaging 1.00
IGL02692:Grk2 APN 19 4290688 splice site probably benign
IGL02870:Grk2 APN 19 4290402 missense probably damaging 1.00
IGL03210:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03227:Grk2 APN 19 4287829 missense probably benign 0.01
IGL03230:Grk2 APN 19 4287829 missense probably benign 0.01
PIT4480001:Grk2 UTSW 19 4287409 missense possibly damaging 0.93
R0008:Grk2 UTSW 19 4287234 missense probably damaging 0.99
R0371:Grk2 UTSW 19 4291586 splice site probably null
R0426:Grk2 UTSW 19 4290600 unclassified probably null
R0494:Grk2 UTSW 19 4291319 missense probably damaging 1.00
R0833:Grk2 UTSW 19 4289357 missense probably damaging 1.00
R1240:Grk2 UTSW 19 4290679 missense probably damaging 1.00
R1499:Grk2 UTSW 19 4287194 missense probably benign 0.11
R1664:Grk2 UTSW 19 4287240 missense possibly damaging 0.48
R1796:Grk2 UTSW 19 4287940 missense probably benign 0.12
R1803:Grk2 UTSW 19 4294883 missense probably damaging 1.00
R2021:Grk2 UTSW 19 4290670 missense probably damaging 1.00
R3947:Grk2 UTSW 19 4292417 missense possibly damaging 0.95
R4551:Grk2 UTSW 19 4286056 missense possibly damaging 0.96
R4945:Grk2 UTSW 19 4290447 missense probably damaging 1.00
R5299:Grk2 UTSW 19 4292771 missense probably damaging 1.00
R5753:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5754:Grk2 UTSW 19 4290468 missense probably damaging 1.00
R5973:Grk2 UTSW 19 4287897 missense possibly damaging 0.88
R6026:Grk2 UTSW 19 4290783 missense probably damaging 0.99
R7117:Grk2 UTSW 19 4290602 critical splice donor site probably null
X0009:Grk2 UTSW 19 4291589 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCATTGCACCAGCTCTGGATCAC -3'
(R):5'- ATGTCCAAGATGGGCAACCCCTTC -3'

Sequencing Primer
(F):5'- AGCTCTGGATCACTCTGTAAAC -3'
(R):5'- AGCGGCGATACTTCTACTTG -3'
Posted On2014-03-14