Incidental Mutation 'R1448:Abca2'
ID159006
Institutional Source Beutler Lab
Gene Symbol Abca2
Ensembl Gene ENSMUSG00000026944
Gene NameATP-binding cassette, sub-family A (ABC1), member 2
SynonymsAbc2, D2H0S1474E
MMRRC Submission 039503-MU
Accession Numbers

NCBI RefSeq: NM_007379.2; MGI: 99606

Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R1448 (G1)
Quality Score200
Status Not validated
Chromosome2
Chromosomal Location25428703-25448540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25440530 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1106 (I1106T)
Ref Sequence ENSEMBL: ENSMUSP00000099983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102919
AA Change: I1106T

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944
AA Change: I1106T

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199405
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype Strain: 3697467; 3719855
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mice show tremors, hyperactivity, abnormal coordination, and alterations in CNS myelin sheath ultrastructure, [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,624,745 probably benign Het
A1cf A T 19: 31,908,796 N35I possibly damaging Het
Abca4 G A 3: 122,162,928 probably null Het
Adgrv1 T C 13: 81,433,513 D4804G probably benign Het
Adk T A 14: 21,052,640 M1K probably null Het
Aff3 T C 1: 38,191,283 N1006D probably damaging Het
Akap12 A G 10: 4,355,475 T762A probably benign Het
Atp12a T A 14: 56,385,839 M843K probably damaging Het
Bbx T A 16: 50,266,270 K169* probably null Het
Bicra A T 7: 15,988,359 V411E possibly damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Cel T C 2: 28,556,326 Y511C probably damaging Het
Celf4 G T 18: 25,503,083 probably null Het
Clasp1 A G 1: 118,508,916 N310S probably benign Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cstf1 A G 2: 172,375,875 D136G probably damaging Het
Cwc22 T A 2: 77,911,555 E470D probably damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Cytip A G 2: 58,145,180 I168T probably damaging Het
D5Ertd579e A G 5: 36,602,739 L1359P probably benign Het
Ddx25 A C 9: 35,557,738 V26G probably benign Het
Dennd4a T A 9: 64,906,045 S1429T possibly damaging Het
Dmd A G X: 84,848,700 D2990G probably damaging Het
Dopey1 C A 9: 86,542,732 probably null Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fabp6 T A 11: 43,596,165 I112F probably benign Het
Fam159b T C 13: 104,845,962 I151V probably benign Het
Fam214a C G 9: 75,010,174 S685* probably null Het
Fbxw10 T C 11: 62,847,592 V104A possibly damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Grin3a T C 4: 49,702,804 Y894C probably damaging Het
Hydin C T 8: 110,446,585 H967Y probably benign Het
Ip6k3 T C 17: 27,145,268 K269E possibly damaging Het
Jup T C 11: 100,383,200 K172E probably damaging Het
Katnal1 T C 5: 148,904,676 D126G probably benign Het
Knl1 A T 2: 119,068,307 K163M probably damaging Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lct T A 1: 128,307,822 I483F probably damaging Het
Loxl2 G A 14: 69,693,040 G751D probably damaging Het
Ltbp4 G A 7: 27,306,577 R1559C possibly damaging Het
Man2c1 T A 9: 57,135,219 D183E probably benign Het
Med17 T C 9: 15,275,843 probably null Het
Mrgpra9 A C 7: 47,235,813 S34R probably benign Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Nat8f1 A G 6: 85,910,942 V12A probably benign Het
Nr2e3 C A 9: 59,943,514 G354V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup155 T C 15: 8,112,406 V94A probably benign Het
Olfr1497 A T 19: 13,794,776 Y278* probably null Het
Olfr294 A T 7: 86,616,361 C95S probably damaging Het
Olfr502 T C 7: 108,523,318 I211V probably benign Het
Olfr649 C T 7: 104,189,875 V111I possibly damaging Het
Pcdhb10 A T 18: 37,412,503 I211F possibly damaging Het
Phip A C 9: 82,915,423 I509S possibly damaging Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psme4 T G 11: 30,852,744 L1487R probably damaging Het
Ptgdr2 A G 19: 10,940,493 S125G probably damaging Het
Ptpro A G 6: 137,441,116 K126E probably damaging Het
Rdh16f2 T A 10: 127,876,925 V264E probably benign Het
Ric8b C T 10: 84,947,671 A131V possibly damaging Het
Rock1 A T 18: 10,070,233 I1280N probably damaging Het
Rprd2 A G 3: 95,818,576 V59A possibly damaging Het
Ruvbl1 T A 6: 88,467,569 C49S probably benign Het
Scn2a A G 2: 65,683,845 N291S probably benign Het
Serbp1 T A 6: 67,277,920 H325Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk3 G A 3: 73,050,341 T366I probably damaging Het
Spryd3 A T 15: 102,118,392 H307Q possibly damaging Het
Spx A T 6: 142,418,513 D100V probably benign Het
Surf4 A G 2: 26,924,464 F142L probably damaging Het
Syne2 T A 12: 76,020,325 probably null Het
Syne2 T C 12: 76,052,178 M5278T possibly damaging Het
Thap12 T C 7: 98,716,023 V466A probably benign Het
Thap3 T C 4: 151,983,216 K135R possibly damaging Het
Tmem131 G T 1: 36,827,358 D448E probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Trim43a G T 9: 88,582,093 C19F probably damaging Het
Trp63 C T 16: 25,889,120 P526L possibly damaging Het
Ubqln3 T C 7: 104,142,790 D31G probably damaging Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Vmn1r40 A G 6: 89,714,576 K125R probably damaging Het
Vmn2r1 A G 3: 64,101,313 Y471C probably damaging Het
Vmn2r13 A G 5: 109,174,135 I232T probably damaging Het
Zfp263 A C 16: 3,746,459 E204D probably benign Het
Zfp865 A T 7: 5,029,279 K88* probably null Het
Other mutations in Abca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Abca2 APN 2 25445963 splice site probably null
IGL01102:Abca2 APN 2 25433956 splice site probably benign
IGL01322:Abca2 APN 2 25446782 splice site probably null
IGL01402:Abca2 APN 2 25442003 missense probably damaging 1.00
IGL01419:Abca2 APN 2 25437514 missense probably damaging 1.00
IGL01490:Abca2 APN 2 25446011 missense probably damaging 1.00
IGL01633:Abca2 APN 2 25444394 missense possibly damaging 0.66
IGL01661:Abca2 APN 2 25442995 missense probably benign 0.01
IGL01804:Abca2 APN 2 25446625 missense probably damaging 1.00
IGL01933:Abca2 APN 2 25444111 missense probably damaging 1.00
IGL01941:Abca2 APN 2 25443095 missense probably benign 0.02
IGL02158:Abca2 APN 2 25447879 utr 3 prime probably benign
IGL02173:Abca2 APN 2 25441897 missense probably benign 0.00
IGL02419:Abca2 APN 2 25446837 missense probably benign
IGL02532:Abca2 APN 2 25435136 missense probably benign 0.03
IGL02572:Abca2 APN 2 25433317 missense possibly damaging 0.95
R0126:Abca2 UTSW 2 25443730 missense possibly damaging 0.88
R0140:Abca2 UTSW 2 25438085 critical splice donor site probably null
R0372:Abca2 UTSW 2 25437353 missense probably damaging 1.00
R0437:Abca2 UTSW 2 25442845 missense probably damaging 0.99
R0505:Abca2 UTSW 2 25434894 missense probably benign 0.22
R0570:Abca2 UTSW 2 25447405 splice site probably null
R1037:Abca2 UTSW 2 25438228 splice site probably benign
R1283:Abca2 UTSW 2 25446689 missense probably damaging 1.00
R1464:Abca2 UTSW 2 25447834 splice site probably benign
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1468:Abca2 UTSW 2 25441296 missense probably damaging 0.99
R1480:Abca2 UTSW 2 25433397 missense possibly damaging 0.60
R1545:Abca2 UTSW 2 25442358 missense probably benign 0.17
R1562:Abca2 UTSW 2 25446319 missense probably benign 0.43
R1569:Abca2 UTSW 2 25439185 missense probably benign 0.45
R1586:Abca2 UTSW 2 25447216 missense probably damaging 0.98
R1635:Abca2 UTSW 2 25444856 missense probably benign 0.03
R1699:Abca2 UTSW 2 25447351 missense possibly damaging 0.80
R1754:Abca2 UTSW 2 25434333 missense probably benign 0.01
R1760:Abca2 UTSW 2 25443043 missense probably benign 0.00
R2040:Abca2 UTSW 2 25443805 missense probably damaging 1.00
R2067:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2111:Abca2 UTSW 2 25437505 missense possibly damaging 0.88
R2248:Abca2 UTSW 2 25433464 splice site probably benign
R2323:Abca2 UTSW 2 25445175 missense probably benign 0.00
R2418:Abca2 UTSW 2 25437989 missense probably benign 0.22
R2419:Abca2 UTSW 2 25437989 missense probably benign 0.22
R3816:Abca2 UTSW 2 25446071 missense probably damaging 1.00
R4180:Abca2 UTSW 2 25441578 missense possibly damaging 0.58
R4431:Abca2 UTSW 2 25442852 missense probably benign
R4468:Abca2 UTSW 2 25444902 missense probably damaging 1.00
R4704:Abca2 UTSW 2 25443412 missense probably damaging 0.99
R4839:Abca2 UTSW 2 25440909 missense probably damaging 0.99
R4933:Abca2 UTSW 2 25444827 missense probably benign 0.25
R4970:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R4971:Abca2 UTSW 2 25441994 missense probably damaging 0.97
R5112:Abca2 UTSW 2 25438371 missense probably damaging 1.00
R5327:Abca2 UTSW 2 25445674 missense probably damaging 1.00
R5378:Abca2 UTSW 2 25446068 missense probably damaging 1.00
R5648:Abca2 UTSW 2 25436498 critical splice donor site probably null
R5725:Abca2 UTSW 2 25439400 missense probably damaging 0.98
R5825:Abca2 UTSW 2 25436736 missense probably benign 0.36
R5837:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5840:Abca2 UTSW 2 25433359 missense probably benign 0.34
R5851:Abca2 UTSW 2 25442310 missense possibly damaging 0.58
R6262:Abca2 UTSW 2 25444910 missense possibly damaging 0.56
R6344:Abca2 UTSW 2 25437694 missense probably damaging 1.00
R6547:Abca2 UTSW 2 25433338 missense possibly damaging 0.80
R6640:Abca2 UTSW 2 25447003 missense possibly damaging 0.65
R6981:Abca2 UTSW 2 25444139 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- tttacgtcccacaAGGGCATGAGC -3'
(R):5'- TCAGCCTCATCCATGTGATGGGTAG -3'

Sequencing Primer
(F):5'- acaAGGGCATGAGCAGAGG -3'
(R):5'- CTTGTACTTCAGAATGAGGTCCCAG -3'
Posted On2014-03-14