Incidental Mutation 'R1448:Ptpro'
ID159033
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Nameprotein tyrosine phosphatase, receptor type, O
SynonymsPtpn15, PTP-oc, GLEPP1, PTP-U2, PTP-BK, PTP-phi, D28, PTPROt
MMRRC Submission 039503-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1448 (G1)
Quality Score207
Status Not validated
Chromosome6
Chromosomal Location137252319-137463233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137441116 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 126 (K126E)
Ref Sequence ENSEMBL: ENSMUSP00000144870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: K975E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: K975E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: K154E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: K154E

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: K947E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: K947E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203914
AA Change: K126E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: K126E

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417H12Rik T A 7: 107,624,745 probably benign Het
A1cf A T 19: 31,908,796 N35I possibly damaging Het
Abca2 T C 2: 25,440,530 I1106T possibly damaging Het
Abca4 G A 3: 122,162,928 probably null Het
Adgrv1 T C 13: 81,433,513 D4804G probably benign Het
Adk T A 14: 21,052,640 M1K probably null Het
Aff3 T C 1: 38,191,283 N1006D probably damaging Het
Akap12 A G 10: 4,355,475 T762A probably benign Het
Atp12a T A 14: 56,385,839 M843K probably damaging Het
Bbx T A 16: 50,266,270 K169* probably null Het
Bicra A T 7: 15,988,359 V411E possibly damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Cel T C 2: 28,556,326 Y511C probably damaging Het
Celf4 G T 18: 25,503,083 probably null Het
Clasp1 A G 1: 118,508,916 N310S probably benign Het
Col6a3 T C 1: 90,781,855 K1873R unknown Het
Cstf1 A G 2: 172,375,875 D136G probably damaging Het
Cwc22 T A 2: 77,911,555 E470D probably damaging Het
Cxcr2 A T 1: 74,158,368 D7V probably benign Het
Cytip A G 2: 58,145,180 I168T probably damaging Het
D5Ertd579e A G 5: 36,602,739 L1359P probably benign Het
Ddx25 A C 9: 35,557,738 V26G probably benign Het
Dennd4a T A 9: 64,906,045 S1429T possibly damaging Het
Dmd A G X: 84,848,700 D2990G probably damaging Het
Dopey1 C A 9: 86,542,732 probably null Het
Eps8 T C 6: 137,522,854 Q209R possibly damaging Het
Fabp6 T A 11: 43,596,165 I112F probably benign Het
Fam159b T C 13: 104,845,962 I151V probably benign Het
Fam214a C G 9: 75,010,174 S685* probably null Het
Fbxw10 T C 11: 62,847,592 V104A possibly damaging Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Grin3a T C 4: 49,702,804 Y894C probably damaging Het
Hydin C T 8: 110,446,585 H967Y probably benign Het
Ip6k3 T C 17: 27,145,268 K269E possibly damaging Het
Jup T C 11: 100,383,200 K172E probably damaging Het
Katnal1 T C 5: 148,904,676 D126G probably benign Het
Knl1 A T 2: 119,068,307 K163M probably damaging Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lct T A 1: 128,307,822 I483F probably damaging Het
Loxl2 G A 14: 69,693,040 G751D probably damaging Het
Ltbp4 G A 7: 27,306,577 R1559C possibly damaging Het
Man2c1 T A 9: 57,135,219 D183E probably benign Het
Med17 T C 9: 15,275,843 probably null Het
Mrgpra9 A C 7: 47,235,813 S34R probably benign Het
Mrpl44 T A 1: 79,777,960 N94K probably damaging Het
Nat8f1 A G 6: 85,910,942 V12A probably benign Het
Nr2e3 C A 9: 59,943,514 G354V probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup155 T C 15: 8,112,406 V94A probably benign Het
Olfr1497 A T 19: 13,794,776 Y278* probably null Het
Olfr294 A T 7: 86,616,361 C95S probably damaging Het
Olfr502 T C 7: 108,523,318 I211V probably benign Het
Olfr649 C T 7: 104,189,875 V111I possibly damaging Het
Pcdhb10 A T 18: 37,412,503 I211F possibly damaging Het
Phip A C 9: 82,915,423 I509S possibly damaging Het
Pkhd1 C T 1: 20,585,157 probably null Het
Psme4 T G 11: 30,852,744 L1487R probably damaging Het
Ptgdr2 A G 19: 10,940,493 S125G probably damaging Het
Rdh16f2 T A 10: 127,876,925 V264E probably benign Het
Ric8b C T 10: 84,947,671 A131V possibly damaging Het
Rock1 A T 18: 10,070,233 I1280N probably damaging Het
Rprd2 A G 3: 95,818,576 V59A possibly damaging Het
Ruvbl1 T A 6: 88,467,569 C49S probably benign Het
Scn2a A G 2: 65,683,845 N291S probably benign Het
Serbp1 T A 6: 67,277,920 H325Q probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk3 G A 3: 73,050,341 T366I probably damaging Het
Spryd3 A T 15: 102,118,392 H307Q possibly damaging Het
Spx A T 6: 142,418,513 D100V probably benign Het
Surf4 A G 2: 26,924,464 F142L probably damaging Het
Syne2 T A 12: 76,020,325 probably null Het
Syne2 T C 12: 76,052,178 M5278T possibly damaging Het
Thap12 T C 7: 98,716,023 V466A probably benign Het
Thap3 T C 4: 151,983,216 K135R possibly damaging Het
Tmem131 G T 1: 36,827,358 D448E probably benign Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Trim43a G T 9: 88,582,093 C19F probably damaging Het
Trp63 C T 16: 25,889,120 P526L possibly damaging Het
Ubqln3 T C 7: 104,142,790 D31G probably damaging Het
Utp14b C A 1: 78,665,445 N353K probably damaging Het
Vmn1r40 A G 6: 89,714,576 K125R probably damaging Het
Vmn2r1 A G 3: 64,101,313 Y471C probably damaging Het
Vmn2r13 A G 5: 109,174,135 I232T probably damaging Het
Zfp263 A C 16: 3,746,459 E204D probably benign Het
Zfp865 A T 7: 5,029,279 K88* probably null Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137394909 critical splice donor site probably null
IGL00844:Ptpro APN 6 137414239 missense probably damaging 1.00
IGL00983:Ptpro APN 6 137418248 missense probably benign 0.01
IGL01073:Ptpro APN 6 137377088 missense probably damaging 1.00
IGL01832:Ptpro APN 6 137393668 missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137454700 missense probably benign 0.37
IGL02387:Ptpro APN 6 137410980 missense probably damaging 0.96
IGL02605:Ptpro APN 6 137380318 missense probably benign 0.02
IGL02666:Ptpro APN 6 137378059 missense probably damaging 0.96
IGL03275:Ptpro APN 6 137450006 missense probably damaging 1.00
court UTSW 6 137393675 nonsense probably null
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0017:Ptpro UTSW 6 137416827 missense probably benign 0.03
R0020:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0022:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0023:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0024:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0094:Ptpro UTSW 6 137386352 missense probably benign 0.08
R0103:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0106:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0316:Ptpro UTSW 6 137376989 missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137368296 missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137414230 missense probably benign 0.04
R0536:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0537:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0552:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0555:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0664:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0708:Ptpro UTSW 6 137386253 missense probably benign 0.26
R0730:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0735:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0738:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0786:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0811:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0812:Ptpro UTSW 6 137368079 missense probably benign 0.00
R0881:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R0973:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1145:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1146:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1147:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1259:Ptpro UTSW 6 137392741 missense probably damaging 0.98
R1340:Ptpro UTSW 6 137441081 missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1382:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1385:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1396:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1401:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1416:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1422:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1513:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1518:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1526:Ptpro UTSW 6 137461726 missense probably damaging 1.00
R1540:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1571:Ptpro UTSW 6 137378130 missense probably benign
R1573:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1587:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1588:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1649:Ptpro UTSW 6 137444017 nonsense probably null
R1700:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1701:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1745:Ptpro UTSW 6 137400645 missense probably benign 0.03
R1772:Ptpro UTSW 6 137430743 missense probably damaging 1.00
R1911:Ptpro UTSW 6 137400619 splice site probably benign
R1958:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R1967:Ptpro UTSW 6 137416865 missense probably benign 0.38
R2025:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2026:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2040:Ptpro UTSW 6 137386164 splice site probably benign
R2115:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2117:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R2130:Ptpro UTSW 6 137411116 splice site probably null
R2161:Ptpro UTSW 6 137449887 missense probably benign 0.01
R2431:Ptpro UTSW 6 137443585 nonsense probably null
R2915:Ptpro UTSW 6 137414241 start gained probably benign
R2988:Ptpro UTSW 6 137443599 nonsense probably null
R3772:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3773:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3795:Ptpro UTSW 6 137380309 missense probably benign
R3885:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3886:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3887:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3888:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R3893:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4032:Ptpro UTSW 6 137461742 missense probably damaging 1.00
R4133:Ptpro UTSW 6 137420372 missense probably damaging 1.00
R4377:Ptpro UTSW 6 137380266 missense probably benign 0.26
R4455:Ptpro UTSW 6 137393659 missense probably damaging 1.00
R4613:Ptpro UTSW 6 137416836 nonsense probably null
R4827:Ptpro UTSW 6 137442710 missense probably damaging 1.00
R4863:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R4870:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R4910:Ptpro UTSW 6 137368338 missense probably damaging 0.99
R4932:Ptpro UTSW 6 137411105 nonsense probably null
R4941:Ptpro UTSW 6 137392765 missense probably damaging 1.00
R4989:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5009:Ptpro UTSW 6 137377132 missense probably damaging 0.96
R5032:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5033:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5162:Ptpro UTSW 6 137443594 missense probably damaging 1.00
R5393:Ptpro UTSW 6 137380224 missense probably benign 0.04
R5423:Ptpro UTSW 6 137442707 missense probably damaging 1.00
R5782:Ptpro UTSW 6 137399498 missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137400706 missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137380608 missense probably benign 0.28
R6488:Ptpro UTSW 6 137393675 nonsense probably null
R6494:Ptpro UTSW 6 137382642 missense probably benign 0.20
R6746:Ptpro UTSW 6 137394823 missense probably damaging 1.00
R6763:Ptpro UTSW 6 137418281 splice site probably null
R6888:Ptpro UTSW 6 137380200 missense probably benign 0.30
R6983:Ptpro UTSW 6 137449917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCTGCCCTTAGAAGGAATCGC -3'
(R):5'- AGGGAGAGTCCAATGCTCAGATGC -3'

Sequencing Primer
(F):5'- GAAGGAATCGCTATGTTATCAGC -3'
(R):5'- TCCACTGAGTAAGACCAGTGC -3'
Posted On2014-03-14